We narrowed to 2,359 results for: mt;
-
Plasmid#250117PurposeBacterial expression of NHERF-1 PDZ domain 2DepositorAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pGEX-nNOS-PDZ-1
Plasmid#250120PurposeBacterial expression of nNOS PDZ domain 1DepositorAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEX-SMG5-14-3-3
Plasmid#250068PurposeBacterial expression of SMG5 14-3-3 like domainDepositorAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEX-gamma-14-3-3
Plasmid#250064PurposeBacterial expression of gamma 14-3-3DepositorAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEX-alpha-1-syntrophin-PDZ-1
Plasmid#250070PurposeBacterial expression of alpha-1-syntrophin PDZ domain 1DepositorAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEX-beta/alpha-14-3-3
Plasmid#250062PurposeBacterial expression of beta/alpha 14-3-3DepositorAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEX-Pdlim5-PDZ-1
Plasmid#250125PurposeBacterial expression of Pdlim5 PDZ domain 1DepositorAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEX-gamma1-syntrophin-PDZ-1
Plasmid#250072PurposeBacterial expression of gamma1-syntrophin PDZ domain 1DepositorAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEX-gamma2-syntrophin-PDZ-1
Plasmid#250073PurposeBacterial expression of gamma2-syntrophin PDZ domain 1DepositorAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-jGCaMP8m-P2A-CyRFP1-WPRE
Plasmid#235249PurposeAAV-mediated and Cre-dependent expression of jGCaMP8m and CyRFP1 in mammalian cellsDepositorInsertsjGCaMP8m
CyRFP1
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBEL2886
Plasmid#232520PurposeExpression plasmid of LetBDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBEL2782
Plasmid#232506PurposeExpression plasmid of LetBDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pBEL2214
Plasmid#232486PurposeExpression plasmid of LetADepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MT2A_beta-Villin
Plasmid#200301PurposeBacterial expression plasmids for production of recombinant fusion protein having beta-domain of metallothionein 2a and chicken Villin headpiece domain HP-35DepositorInsertbeta-domain of metallothionein 2a in fusion with HP-35 (MT2A Human)
TagsChiting Binding Domanin-InteinExpressionBacterialPromoterT7Available SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GLRX-roGFP2 in pT3TS-Dest
Plasmid#194297PurposeIn vitro transcription of the redox sensor GLRX-roGFP2 from the T3 promoter. Parton lab clone KRKDepositorInsertGLRX-roGFP2
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACE-K2P4.1-StrepTagII
Plasmid#191474PurposeExpresses K2P4.1 with C-terminal StrepTagIIDepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_AfLEA1.1 (pBS0741)
Plasmid#185233PurposeFor the mammalian expression of the brine shrimp protein AfLEA1.1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAfLEA1.1
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_CAHS1_HYPDU (pBS0650)
Plasmid#185194PurposeFor the mammalian expression of the tardigrade protein CAHS1_HYPDU. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS1_HYPDU
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOA4_HUMAN (pBS0645)
Plasmid#185190PurposeFor the mammalian expression of the human protein APOA4_HUMAN. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOA4_HUMAN
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_A0A1D1UKG0_RAMVA (pBS0352)
Plasmid#185188PurposeFor the mammalian expression of the tardigrade protein A0A1D1UKG0_RAMVA. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertA0A1D1UKG0_RAMVA
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_B1PM76_ARTSF (pBS0329)
Plasmid#185176PurposeFor the mammalian expression of the brine shrimp protein B1PM76_ARTSF. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertB1PM76_ARTSF
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_B9VQB0_ARTSF (pBS0327)
Plasmid#185175PurposeFor the mammalian expression of the brine shrimp protein B9VQB0_ARTSF. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertB9VQB0_ARTSF
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_A6YT97_ARTSF (pBS0322)
Plasmid#185172PurposeFor the mammalian expression of the brine shrimp protein A6YT97_ARTSF. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertA6YT97_ARTSF
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_A0A1D1UJP0_RAMVA (pBS0306)
Plasmid#185166PurposeFor the mammalian expression of the tardigrade protein A0A1D1UJP0_RAMVA. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertA0A1D1UJP0_RAMVA
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_BnHD (pBS0280)
Plasmid#185155PurposeFor the mammalian expression of the rapeseed protein BnHD. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertBnHD
ExpressionMammalianAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_CAHS1_RAMVA (pBS0267)
Plasmid#185150PurposeFor the mammalian expression of the tardigrade protein CAHS1_RAMVA. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS1_RAMVA
ExpressionMammalianAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCh-2xFKBP (no insert) (pBS1139)
Plasmid#185322PurposeThe empty vector used for the FKBP experiments in our paperDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
empty-mCh-SspB (pBS1140)
Plasmid#185323PurposeThe empty vector used for the iLID-SspB experiments in our paperDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_AfrLEA2 (pBS0910)
Plasmid#185284PurposeFor the mammalian expression of the brine shrimp protein AfrLEA2. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAfrLEA2
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DHN_CsLEA11 (pBS0786)
Plasmid#185255PurposeFor the mammalian expression of the Cucumber protein DHN_CsLEA11. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDHN_CsLEA11
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DHN_AmDHN132 (pBS0781)
Plasmid#185253PurposeFor the mammalian expression of the Ammopiptanthus protein DHN_AmDHN132. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDHN_AmDHN132
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_TJ190_negative (pBS0773)
Plasmid#185250PurposeFor the mammalian expression of the synthetic protein TJ190_negative. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertTJ190_negative
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_SAHS4_k1_0 (pBS0769)
Plasmid#185249PurposeFor the mammalian expression of the tardigrade protein SAHS4_k1_0. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertSAHS4_k1_0
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pK-eCFP
Plasmid#176559PurposeExpression of eCFP for auxotrophic selection in the absence of histidineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceDec. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHA850 - osm-10p::FynY531F
Plasmid#139207PurposeExpress activated Fyn kinase in osm-10 neuronsDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA852 - mec-4p::FynY531F
Plasmid#139209PurposeExpresses activated Fyn kinase in mec-4 neuronsDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUS_LC_withR
Plasmid#139128Purposeexpress FUS LC with the same number and spacing of arginines as hnRNPA2 LCDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
TOG_D1
Plasmid#139112Purposeexpress first domain (1-250) of TOGDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only