We narrowed to 4,443 results for: GCA
-
Plasmid#170121PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with 8bp bulge loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Plxnd1 sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239032PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172669PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertRNF2 pegRNA and RNF2_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7534 pHR (hU6-crSURF1-EFS-PuroR-WPRE)
Plasmid#214878PurposeLentiviral vector encoding RfxCas13d targeting SURF1 guide arrayDepositorInserthU6-crSURF1-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCoHygro L16_shRNA of spliced Copia
Plasmid#71389Purposeknock down expression of spliced Copia in Drosophila melanogasterDepositorInsertCopia
ExpressionInsectPromoterU6Available SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRNegativex3-WPRE-bGHpA
Plasmid#194249PurposeExpresses 3 non-targeting miRNAsDepositorInsertmiRNegative
UseAAV and RNAiPromoterCAGAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
OgeuIscB CAG RNA
Plasmid#222867PurposeThis plasmid codes for the guide of the OgeuIscB with a CAG targetDepositorInsertOgeuIscB omega RNA with a (CAG)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pWT016i
Plasmid#96856Purposetheophylline-agRNA-GFPDepositorInserttheophylline-agRNA-GFP
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT016l
Plasmid#96857Purpose(d)theophylline-agRNA-GFPDepositorInsert(d)theophylline-agRNA-GFP
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT055b
Plasmid#96877Purposetheophylline-agRNA-FANCFDepositorInserttheophylline-agRNA-FANCF
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCPP5912
Plasmid#128703PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) and chaperone Gateway donor cloneDepositorInsertshcE-avrE1
ExpressionBacterialMutationThree synonymous mutations Ala 362 (GCT-GCC), Ala…Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgSat-MTSb/BFP/pdCas9-C1
Plasmid#162761PurposeExpressing dCas9 and sgRNA containg MTSa targeting centromeresDepositorInsertdCas9 and sgRNA(SL2-sgSat-MTSb)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-ALDOB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172668PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human ALDOB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertALDOB pegRNA and ALDOB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDP010
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-11mer-35kb-DSF-1-11
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-VGAT sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239030PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only