We narrowed to 19,404 results for: MUT
-
Plasmid#186894PurposeDoxycycline-dependent expression of human cGAS gene (with R255E mutation) in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with R255E mutation and C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsHAMutationN-terminal truncation, R255EPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Htt171-66Q-myc-WPRE
Plasmid#107934PurposeAdeno-Associated viral (AAV) vector plasmid expressing exon1 of mutant HTT (mHTT, 66 polyQ repeats) in neuronsDepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-K121M
Plasmid#64877Purposelentiviral expression of human POLQ K121M mutant (a mutation in the conserved ATP-binding site of the Walker A motif in the helicase-like domain)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationK121M, a mutation in the conserved ATP-binding si…PromoterEF1alphaAvailable SinceOct. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato]
Plasmid#62723PurposeAAV-mediated expression of ChrimsonR-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. TdTomato is a codon diversified version.DepositorHas ServiceAAV1 and AAV5InsertChrimsonR-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationChrimson K176R mutantPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12V-IRES-mCherry
Plasmid#221025PurposeFluorescent reporter for expressing the KRAS G12V mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC0054-CMV-dPspCas13b-longlinker-ADAR2DD(E488Q/T375G)
Plasmid#103870PurposeHigh specificity version of dPspCas13b-ADAR2DD(E488Q) fusions. T375G mutation in the ADAR deaminase domain confers increased specificity with slightly reduced activity.DepositorInsertsUseCRISPRTagsGSGGGGS and HIV NESExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-ChrimsonR-tdTomato
Plasmid#99231PurposeAAV-mediated expression of ChrimsonR-tdTomato under the CaMKII promoter. tdTomato has codons varied between the first and second tandem repeats to reduce recombination. Using SV40 signal.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationChrimson K176R mutantPromoterCaMKIIAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV Marina-T2A-nls-mCherry
Plasmid#74216Purposegenetically-encoded fluorescent voltage indicatorDepositorInsertfluorescent protein voltage sensor
TagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterCMVAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-ChrimsonR-GFP
Plasmid#122063PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α promoter (1.1kb short version). Using SV40 pA signal.DepositorHas ServiceAAV2InsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1a(1.1kb short version)Available SinceMarch 28, 2020AvailabilityAcademic Institutions and Nonprofits only