We narrowed to 9,265 results for: yeast expression
-
Plasmid#99531PurposeS. cerevisiae expression of F-box protein AFB2 under control of the ADH1 promoter, TRP1 marker (for use with the AID degron system)DepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pGR595
Plasmid#213785PurposeIntegrates at the CAN1 locus the BadBoy2 TP-DNAP1 variant and the Nourseothricin resistance marker. Includes an I-SceI transient expression cassette.DepositorInsertBadBoy2 TP-DNAP1
UseSynthetic BiologyTagsExpressionYeastMutationPromoterAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS303-PADH1-AFB2
Plasmid#99530PurposeS. cerevisiae expression of F-box protein AFB2 under control of the ADH1 promoter, HIS3 marker (for use with the AID degron system)DepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHflu4
Plasmid#203882PurposepHI1 with insertion of monomeric red fluorescent protein (mRFP)DepositorInsertmonomeric red fluorescent protein
UseSynthetic BiologyTagsExpressionBacterial and YeastMutationPromoterAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
STK25
Plasmid#39075PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-TAF15
Plasmid#181713PurposeGalactose inducible expression of TAF15DepositorAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXP420 v2 (repaired Amp promoter)
Plasmid#86920PurposeShuttle vector to facilitate gene expression for metabolic engineering in S. cerevisiae. Contains TEF1 promoter and CYC1 terminator for insertion of gene of interest. Contains HIS3 selection marker.DepositorTypeEmpty backboneUseCre/LoxTagsExpressionYeastMutationPromoterTEF1Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-Prepro-3x-Adan
Plasmid#181733PurposeGalactose inducible expression of Prepro-3x-AdanDepositorInsertPrepro-3x-Adan
UseTagsExpressionYeastMutationPromoterAvailable SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG416-GAL-RNQ1
Plasmid#181706PurposeGalactose inducible expression of RNQ1DepositorAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-msYFP2
Plasmid#218969PurposeGene replacement plasmid to label S. cerevisiae Sec7 with msYFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGR475
Plasmid#213784PurposeIntegrates at the CAN1 locus the WT TP-DNAP1 and the Hygromycin resistance markerDepositorInsertWT TP-DNAP1 (recoded)
UseSynthetic BiologyTagsExpressionYeastMutationPromoterAvailable SinceMarch 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLK89 - Edit-directing plasmid cloning insert
Plasmid#98846PurposeContains the insert used for step 2 of edit-directed plasmid cloningDepositorInsertKanR
UseCRISPRTagsExpressionYeastMutationChanged sequence to remove a MluI cut sitePromoterAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pREP4xV5_ccdB
Plasmid#79016PurposeGateway destination vector for S. pombe. Allow sequence of interest to be fused to N-terminal double V5 epitope tag. attR1-CmR-ccdB-attR2 cassette, nmt1 (ATATATAAA) promoter, ura4+ selectionDepositorTypeEmpty backboneUseTagsdouble V5 epitope tagExpressionYeastMutationPromoterAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pREP3xV5_ccdB
Plasmid#79015PurposeGateway destination vector for S. pombe. Allow sequence of interest to be fused to N-terminal double V5 epitope tag. attR1-CmR-ccdB-attR2 cassette, nmt1 (ATATATAAA) promoter, LEU2 selectionDepositorTypeEmpty backboneUseTagsdouble V5 epitope tagExpressionYeastMutationPromoterAvailable SinceJuly 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
HCP2
Plasmid#166104PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP3
Plasmid#166105PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP7
Plasmid#166109PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Whi5 and the other targets the C-terminus of Hta2.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only