We narrowed to 61,074 results for: promoter
-
Plasmid#138575PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17848003_17849903DepositorAvailable sinceMay 27, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pGL4.24-Cd36-enhancer5
Plasmid#138577PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17893352_17894696DepositorAvailable sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGL4.24-Cd36-enhancer2
Plasmid#138574PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17843052_17844983DepositorAvailable sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAGM28521
Plasmid#105359PurposeSynthetic biologyDepositorInsertEC1.2en-EC1.1p fusion promoter
UseSynthetic BiologyMutationBsaI/ BpiI restriction sites removedAvailable sinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICSL11058
Plasmid#68254PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting PM19_3 in barleyDepositorInsertPromoter_TaU6 + sgRNA_HvPM19_3
UseSynthetic BiologyExpressionPlantAvailable sinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMV-d2eGFP-20pf
Plasmid#21971DepositorPublicationInsertCMV d2eGFP miR-20 perfect
ExpressionMammalianAvailable sinceNov. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CB-IRES-copGFP-T2A-Puro
Plasmid#72299PurposeExpress gene of interest under CB promoterDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterchicken beta-actin + CMV enhancerAvailable sinceJan. 25, 2016AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pAAV-hsyn1-synaptophysin-mCherry-V5
Plasmid#250167PurposeNeuronal overexpression of synaptophysin fused to mCherryDepositorAvailable sinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
907H1
Plasmid#160234PurposeFlightN-CymR-VP16-3X-SV40-attBDepositorInsertsp-cymene repressor
Flightin promoter
TagsVP16ExpressionInsectAvailable sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6b
Plasmid#117222PurposeExpresses gRNA in Aedes aegyptiDepositorInsertHR U6b promoter-gRNA
UseSynthetic BiologyExpressionInsectPromoterU6Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJH124
Plasmid#48259PurposeTemplate plasmid for PCR-based transplant of Ashbya gossypii TEF1 promoter in yeast.DepositorInsertsURA3 3' fragment
URA3 5' fragment
Ag TEF1 promoter
UseRoutine cloning vectorMutation-242 upstream to URA3 ORF +495 and URA3 ORF from …PromoterAg TEF1 promoterAvailable sinceFeb. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-2.5Kb MMP10
Plasmid#53973PurposeLuciferase reporter for mouse MMP10 2.5kb promoterDepositorInsertmouse MMP10 2.5Kb promoter (Mmp10 Mouse)
UseLuciferaseExpressionMammalianPromoterPCR from C57BL6/JAvailable sinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRBBm34
Plasmid#48114PurposeExpression of the gfp gene under control of the native xylose inducible promoter of Bacillus megateriumDepositorInsertgfp
UseSynthetic BiologyExpressionBacterialAvailable sinceOct. 11, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA-emerin-EGFP-polyA
Plasmid#59747PurposeExpress emerin-EGFP in mammalian cells (CMV promoter). Also suitable for in vitro transcription (T7 promoter) for injecting mRNA into oocytes.DepositorInsertemerin-EGFP
TagsEGFPExpressionMammalianPromoterCMV and T7Available sinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJH131
Plasmid#48260PurposeTemplate plasmid for PCR-based transplant of Saccharomyces cerevisiae GAL10/GAL1 bidirectional promoter in yeast.DepositorInsertsURA3 3' fragment
URA3 5' fragment
GAL10/GAL1 bidirectional promoter
UseRoutine cloning vectorMutation-242 upstream to URA3 ORF +495 and URA3 ORF from …PromoterGAL10/GAL1 bidirectionalAvailable sinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTone-gata2aECE-Kaede
Plasmid#132976Purposegata2a endothelial enhancer (x6) and basal promoter driving kaede in pTol1 backboneDepositorInsertsKaede
gata2a endothelial enhancer (x6) and a carp b-actin basal promoter
UseUnspecified; Transposon-mediatedAvailable sinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
plentiCMV-sct-p5-b2m-HLA-A0101
Plasmid#196512PurposeExpress single-chain peptide-MHC (CMV p5 epitope on HLA-A0101)DepositorInsertsingle chain of a CMV peptide, b2m and HLA A0101
UseLentiviralTagsNAExpressionMammalianMutationY84CPromoterCMVAvailable sinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
-948 hTF
Plasmid#15441DepositorPublicationAvailable sinceJuly 27, 2007AvailabilityAcademic Institutions and Nonprofits only