We narrowed to 24,867 results for: promoter
-
Plasmid#187952PurposeFKBP12 (F36V mutant) degron-tagged CasRx fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-CasRx-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linker, HA-tag, and NLSExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-LgBiT-SpyCatcher
Plasmid#223634PurposeProtein purification of SpyCatcher003 (S49C) with LgBiT and 6xHis tags from E. coliDepositorInsertSpyCatcher003 S49C
TagsHis6, LgBiTExpressionBacterialAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-SP110C
Plasmid#65393PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertSP110C
TagsEmGFP and V5ExpressionMammalianMutationnonePromoterCMVAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-SP110A
Plasmid#65392PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertSP110A
TagsEmGFP and V5ExpressionMammalianMutationnonePromoterCMVAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJR98
Plasmid#187239PurposeCR3 constant region - hU6 sgRNA promoter flanked by BsmBI sitesDepositorInsertCR3 constant region - hU6 sgRNA promoter flanked by BsmBI sites
ExpressionBacterialAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGWB453
Plasmid#74835PurposeGateway cloning compatible binary vector for C-terminal fusion with mRFP (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-1
Plasmid#121533PurposesgITGB1-1 sequence: GAAGCAGGGCCAAATTGTGGG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVKS-1
Plasmid#233086PurposeHNRNPD full-length promoter reporter constructDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX307 P2A GFP Luciferase
Plasmid#193674PurposeConstitutive lentiviral expression of LuciferaseDepositorInsertLuciferase
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α wt-pBabe-Puro
Plasmid#26055DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationwt cDNAAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ERT2-iCre-ERT2
Plasmid#178059PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under Syn promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman synapsin 1 (Syn) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3 GCN1-3xFlag_IRES-iRFP
Plasmid#198388PurposeGCN1 expressionDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCV-dGFP-JARID1C
Plasmid#74776Purposeretroviral expression of JARID1CDepositorAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-gePSI-pCamk2a-AcGFP
Plasmid#133732PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a Camk2a promoter.DepositorInsertsgePSI-β-chain
gePSI-α-chain
AcGFP1
UseAAVTagsmurine ornithine decarboxylase - degron (ODC36)ExpressionMammalianPromoterpCamk2a and pTRE3G-BiAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
5HRE/GFP
Plasmid#46926Purposehypoxia-responsive enhanced green fluorescent protein (EGFP)-based systemDepositorInsert5X HRE of VEGF (VEGFA Human)
Tagsd2EGFPExpressionMammalianMutationfive copies of a 35-bp fragment from the hypoxia-…PromoterEF-1α promoterAvailable SinceAug. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX333
Plasmid#64073PurposeVector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags3XFLAG-Cas9ExpressionMammalianPromoterCBh; U6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AsCas12a-P2A-EGFP (RTW2861)
Plasmid#160140PurposeCMV and T7 promoter expression plasmid for human codon optimized AsCas12a with a c-terminal NLS(nucleoplasmin), 3x HA tag, and P2A-EGFPDepositorInserthuman codon optimized AsCas12a with NLS(nucleoplasmin)-3xHA-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsNLS(nucleoplasmin)-3xHA-P2A-EGFPExpressionMammalianPromoterCMV and T7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/Myc-DNMT1
Plasmid#36939PurposeMammalian expression of human DNMT1 with myc tagDepositorAvailable SinceJune 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-mNeonGreen
Plasmid#162034PurposeTagged vector controlDepositorTypeEmpty backboneUseLentiviralTagsNeon GreenAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only