We narrowed to 15,880 results for: nans
-
Plasmid#193122PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.2
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3274
Plasmid#193136PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA3 (GB1724) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G3aG2b.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2889
Plasmid#193127PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3272
Plasmid#193134PurposeA2 Proximal promoter sequence consisting of the target sequence for the gRNA1 (GB1838) at "b site" (-210 from TSS).DepositorInsertGB_SynP (A2) G1b.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2891
Plasmid#193128PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2885
Plasmid#193123PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2879
Plasmid#193116PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3278
Plasmid#193132PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3273
Plasmid#193135PurposeA2 Proximal promoter sequence consisting of the target sequence for the gRNA1 (GB1838) at "e site" (-320 from TSS).DepositorInsertGB_SynP (A2) G1e.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBXPHM3-NB-D6
Plasmid#167989Purposeexpression of a nanobody against rat PepT2 as a n terminal MBP fusionDepositorInsertNanobodyD6
TagsHis-MBPExpressionBacterialPromoterpBADAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
mouse KANK4-Y801H Ankyrin Repeats pET151
Plasmid#164058PurposeExpresses mouse KANK4 Ank domain -Y801H mutant in bacterial cellsDepositorInsertKidney Ankyrin Repeat-Containing Protein 4 Y801H mutant (Kank4 Mouse)
TagsHis-tag, TEV cleavage siteExpressionBacterialPromoterT7Available SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST tol2 UbB polyA
Plasmid#188701PurposeGateway destination vector containing the zebrafish ubiquitin B polyadenylation sequenceDepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSub-Asp6-MBP-HRas
Plasmid#185758PurposeBacterial expression of Asp6-MBP-HRasDepositorInsertAsp6-MBP-HRas
TagsMBPExpressionBacterialMutation6x Asp added to the N terminus of MBPPromotertacAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Antares2-N1
Plasmid#120869PurposePiggybac transposon plasmid for live animal optical imagingDepositorInsertAkaluc
ExpressionMammalianPromoterCMV PromoterAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS105
Plasmid#174830PurposeEncodes a unique yeast telomere end at TEL11R by removing the subtelomereDepositorInsert11R Unique
TagsGAL4 5XUASExpressionBacterialMutationChanging TEL11R to a unique endPromoterlac promoterAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWSK129-stm2585-gp130
Plasmid#174404PurposeBacterial expression of sarA-gp130 chimera under native promoter.DepositorInsertsarA-IL6ST chimera
ExpressionBacterialPromoterEndogenousAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27Linear-1, PolyU(0), Hairpin Distance = 0nt
Plasmid#166993PurposeTests for the impact of a synthetic linear tract in conjunction with a hairpin motif on human polymerase III transcription from a U6 promoter.DepositorInsertTermination module:PolyU(0), Hairpin = 0 nt
ExpressionMammalianAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
GLY, Linear-3, PolyU(4)
Plasmid#166989PurposeTests for the impact of 4 uracil in a poly-uracil tract on human polymerase III transcription from a GLY tRNA promoter.DepositorInsertTermination module:PolyU(4)
ExpressionMammalianAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only