We narrowed to 15,832 results for: grna
-
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRTagsExpressionMutationPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
OgeuIscB CTG RNA
Plasmid#222865PurposeThis plasmid codes for the guide of the OgeuIscB with a CTG targetDepositorInsertOgeuIscB omega RNA with a (CTG)6 target sequence
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available SinceOct. 17, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
OgeuIscB GCT RNA
Plasmid#222862PurposeThis plasmid codes for the guide of the OgeuIscB with a GCT targetDepositorInsertOgeuIscB omega RNA with a (GCT)6 target sequence
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
OgeuIscB GCA RNA
Plasmid#222864PurposeThis plasmid codes for the guide of the OgeuIscB with a GCA targetDepositorInsertOgeuIscB omega RNA with a (GCA)6 target sequence
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
OgeuIscB TGC RNA
Plasmid#222863PurposeThis plasmid codes for the guide of the OgeuIscB with a TGC targetDepositorInsertOgeuIscB omega RNA with a (TGC)6 target sequence
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
OgeuIscB AGC RNA
Plasmid#222866PurposeThis plasmid codes for the guide of the OgeuIscB with a AGC targetDepositorInsertOgeuIscB omega RNA with a (AGC)6 target sequence
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
OgeuIscB CAG RNA
Plasmid#222867PurposeThis plasmid codes for the guide of the OgeuIscB with a CAG targetDepositorInsertOgeuIscB omega RNA with a (CAG)6 target sequence
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pmiRNA1-OE-METTL16 PP185/186AA-sgMETTL16-MUT1
Plasmid#196205Purposeoverexpress mutant METTL16DepositorInsertMETTL16 PP185/186AA (METTL16 Human)
UseLentiviralTagsExpressionMutationPP185/186AAPromoterAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAIO-Ef1a-PE2-GFP:KCNQ2-C201R_pp
Plasmid#185061PurposeEf1a driven PE2 with pegRNA for editing C201R mutation (including silent PAM mutation) in KCNQ2. See Addgene plasmid #184445DepositorInsertU6:pegRNA:scaffold:PBS+RT template
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hARAF-1
Plasmid#185367PurposeFor mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAFDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-mAK1-shRNA-1
Plasmid#185364PurposeFor mammalian expression of shRNA: ATCTTGACTCCCTGAAGTAAC that targets mouse AK1 (adenylate kinase)DepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgVamp1
Plasmid#159919PurposeMutagenesis of Vamp1DepositorAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Dox human Citron shRNA 1 GFP
Plasmid#155291PurposeLentivirus for doxycycline inducible expression of human Citron shRNA, GFP marker, based on Addgene 11652DepositorAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 GFP
Plasmid#155286PurposeLentiviral expression of human CIT shRNA, GFP expression, based on Addgene 12247DepositorAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pARID4B.1.0-gDNA
Plasmid#132436PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSRNP3.1.0-gDNA
Plasmid#132472PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHOXB6.1.0-gDNA
Plasmid#132458PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGTF2I.1.0-gDNA
Plasmid#132452PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHMG20B.1.0-gDNA
Plasmid#132449PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMECOM.1.0-gDNA
Plasmid#132445PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLF10.1.0-gDNA
Plasmid#132433PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
mmu-miR-30a natural design (NAT)
Plasmid#107791PurposemiR-30a RNAi ExpressionDepositorInsertwhole pre-mmu-miR-30a gene (Mir30a Mouse)
UseRNAiTagsEmGFPExpressionMammalianMutationPromoterCMVAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Blast
Plasmid#83480PurposeMammalian expression of Cas9 and sgRNA scaffoldDepositorInsertBlasticidin S deaminase
UseCRISPR and LentiviralTagsExpressionMammalianMutationReplaced puromycin N-acetyltransferase on the ori…PromoterEF-1αAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-ON-shCtrl (neo)
Plasmid#192076PurposeLentivirus for Dox-inducible expression of a non-targeting control shRNADepositorInsertnon-targeting randomized sequence
UseLentiviralTagsExpressionMutationPromoterH1 / Tet-responsive elementAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgRosa26
Plasmid#159915PurposeMutagenesis of Rosa26DepositorInsertRosa26 (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A iRFP670 P2A puro
Plasmid#122182PurposeThe plasmid codes for a Flag-spCas9 protein, a iRFP670 fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLIK sh human Rb 1534 hyg
Plasmid#31500DepositorInsertRB shRNA (RB1 Human)
UseLentiviral and RNAiTagsEGFPExpressionMammalianMutationThe target sequence for shRB 1534 is GAACGATTATCC…PromoterAvailable SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLV-tTRKRAB
Plasmid#12249DepositorInsertTetR-KRAB fusion
UseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationPromoterAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_human_ADAR1_ccC
Plasmid#158115Purposedeletion hADAR1DepositorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only