We narrowed to 13,058 results for: BASE
-
Plasmid#33291DepositorAvailable SinceDec. 5, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pT2/CMV-eGFP.PB/PTK
Plasmid#170540PurposeExpresses the puromycin resistance gene fused to a thymidine kinase, upon excision of this cassette the reading frame of eGFP is restoredDepositorInsertDelta 5'-eGFP CMV-PuroTK- Delta 3'-eGFP
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVRc22_4450
Plasmid#49741DepositorInsertAS22_4450
UseSynthetic BiologyExpressionBacterialMutationCodon optimized for E.coliPromoterpLuxAvailable SinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
LLP789_αGCN4-DNMT3A-CO
Plasmid#211783PurposeSunTag counterpart binding domain, aGCN4, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorInsertaGCN4-DNMT3A
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAT15546_nABE8e-SuperFi-Cas9
Plasmid#184376PurposeMammalian expression of SuperFi-Cas9 ABE8e base editorDepositorInsertnABE8e-SuperFi-Cas9
UseCRISPRTagsNucleoplasmin NLS and SV40 NLSExpressionMammalianMutationD10A, Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q10…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL1180-HR-PUbEGFP-NLS
Plasmid#176681PurposeExpression of nuclear localized EGFP under Ae. aegypti Polyubiquitin promoter (AAEL003888), EGFP version of pSL1180-HR-PUbECFP (Addgene #47917)DepositorInsertEGFP
ExpressionInsectPromoterAe. aegypti poly-ubiquitin (AAEL003888)Available SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTS115 pHAGE2 CMVtetO2 MCS-3C-SUMOstar-22xGS-Alfa-P2A-TagBFP
Plasmid#199368PurposeLentiviral transfer plasmid for doxycycline inducible expression of a C-terminally 3C-SUMOstar-ALFA-P2A-BFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTags3C-SUMOstar-ALFA-P2A-TagBFPExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTW102
Plasmid#115945PurposeORF insert for replicon MoCloDepositorInsertLvl0 DDd-L7Ae
UseSynthetic BiologyAvailable SinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSW002-PpsbA-mNeonGreen
Plasmid#205017PurposeBroad host-range bacterial expression vector with constitutive PsbA promoter; mNeonGreen (codon optimized for P. fluorescens)DepositorInsertmNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPpsbAAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
cycLuc_SuMMVs
Plasmid#119210PurposeCircularly permutated firefly luciferase with SuMMVs cleavage site (Luciferase reporter for detection of proteolytic activity)DepositorInsertcyclic luciferase with SuMMVp cleavage site
UseLuciferaseTagsAU1 tagExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-P1-N-miRFP670-C
Plasmid#159438PurposeCRISPR knock-in donor construct with fluorescent reporterDepositorInsertmiRFP670
UseCRISPRTags3' linker pair 1, 5' linker pair 1, C t…PromoterCMVAvailable SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFR∆550-580-mEGFP
Plasmid#203788PurposeNumber and brightness analysis of EGFR oligomerizationDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 integrase (GB1496)
Plasmid#160578PurposeStreptomyces phage PhiC31 integrase, complete CDSDepositorInsertPhiC31
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
JBEI-3716
Plasmid#100169PurposeUsed to improve production from engineered biosynthetic pathways include optimizing codon usage, enhancing production of rate-limiting enzymes, and eliminating the accumulation of toxic intermediates or byproducts to improve cell growthDepositorInsertcodon-optimized MK
ExpressionBacterialAvailable SinceSept. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-synPCB2.0
Plasmid#139477PurposeExpression vector for phycocyanobilin (PCB) synthesis in mammalian cells.DepositorInsertMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Fnr-Fd-T7
ExpressionMammalianMutationV413LPromoterCAG promoterAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
JP705: pMVP/SB/Neo-DEST
Plasmid#121866PurposepMVP destination vector, empty Sleeping Beauty transposon vector backbone w/ Neo selection cassetteDepositorTypeEmpty backboneUseSleeping beauty transposon, pmvp gateway destinat…ExpressionMammalianAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LC501: pMVP (L3-L2) mCherry + polyA
Plasmid#121765PurposepMVP L3-L2 entry plasmid, contains mCherry + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term mCherry fusion to gene of interest.DepositorInsertmCherry + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
p1.2-Zeo-eGFP
Plasmid#162743PurposeFluorescent reporter for CHO cells expression studiesDepositorInsertenhanced green fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-RFP
Plasmid#166843PurposeExpresses ER localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsRFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only