We narrowed to 61,074 results for: promoter
-
Plasmid#226786PurposeTransgenic Cre-inducible mCherry expression for lineage tracing in all cell types. Includes green heart marker (pGH).DepositorInsertsUseCre/Lox; Zebrafish expressionAvailable sinceJuly 28, 2026AvailabilityAcademic Institutions and Nonprofits only
-
RSRF-Luc-2mut
Plasmid#31819DepositorInsertMutant MEF2-dependent promoter (-307 to -242 of Nur77/NR4A1)
UseLuciferaseExpressionMammalianMutationtwo CTATATTTAG RSRF sites mutated to CGATATTTCGPromotermutated MEF2-dependent (-307 to -242 of Nur77/NR4…Available sinceAug. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pbacNeoR
Plasmid#26349DepositorInsertBacterial promoter::NeoR::bacterial 3p flank
ExpressionBacterialAvailable sinceDec. 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRB2960
Plasmid#8677DepositorAvailable sinceJune 30, 2005AvailabilityAcademic Institutions and Nonprofits only -
-
pGG198
Plasmid#165605PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with two hEGFP protospacers: PS1(upstream of promoter with 'CAGCG' PAM)-lac-PS2(downstream with 'CGGCG' PAM)-HIS3 and GFPDepositorInserthEGFP protospacer ('CGGCG' PAM) downstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutationSecondary protospacer ('CGGCG' PAM) ins…PromoterlacAvailable sinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMU-NUCr
Plasmid#61168PurposeFluorescent reporter for nucleus NLS-mCherry-GUS expressed under AtUBQ10 promoterDepositorInsertNLS-mCherry-GUS
ExpressionPlantPromoterAtUBQ10Available sinceFeb. 23, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMU-MTUBr
Plasmid#61196PurposeFluorescent reporter for microtubules mCherry-MAP4-MBD expressed under AtUBQ10 promoterDepositorInsertMAP-MBD
TagsmCherryExpressionPlantPromoterAtUBQ10Available sinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
INCTbiosyn-p35S(rc)2_4_5-GFP
Plasmid#127520PurposePlasmid has an inverted CaMV 35S promoter sequence (reverse complement) flanked by attB and attP attachment sites of integrases 2, 4, and 5. EGFP coding sequence is in the forward orientation.DepositorInsertCaMV 35S reverse complement promoter sequence flanked by attB/attP Integrase 2, 4 and 5 attachment sites.
ExpressionPlantAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFS461
Plasmid#89064Purposeleu1 integration plasmid with adh1pr:Z3EVDepositorInsertZ3EV artificial transcription factor
UseLeu1 integrating vectorPromoteradh1Available sinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSIR-neo
Plasmid#51128PurposeSelf-inactivating retrovirus vector containing a neomycin-resistance geneDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable sinceFeb. 19, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-rInsp-hIns-GLuc
Plasmid#89927PurposeExpresses Insulin-GLuc from the rat insulin promoter. Gaussia Luc is inserted within the C-peptide and is co-secreted with insulin.DepositorInserthuman insulin-Gaussia-Luciferase (INS Synthetic, Human)
UseLentiviralExpressionMammalianMutationDNA sequence for Gaussia luciferase was humanized…Promoter410bp rat insulin II promoterAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p5E-Ui4-eSIBR
Plasmid#82586Purpose5'entry vector containing human ubiquitin C promoter followed by intronically-expressed eSIBR cassette for ubiquitous expression, RNAiDepositorInserthuman ubiquitin C promoter followed by intronically expressed eSIBR cassette
PromoterNoneAvailable sinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-EGFP
Plasmid#153163PurposeMouse gamma-synuclein (mSncg) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianPromotermSncgAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRL128
Plasmid#40180DepositorInsertsPtac-lacO
araC-pBAD
PromoterBAD and tacAvailable sinceJan. 25, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIGneo
Plasmid#52116Purposea bicistronic IRES-GFP containing vector for mammalian expression (CMV promoter)DepositorTypeEmpty backboneTagsIRES-EGFPExpressionMammalianPromoterCMVAvailable sinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CaMKIIa-Archer1-EGFP
Plasmid#60423PurposeLentiviral vector with CaMKIIa promoter and upstream CMV promoter expressing Archer1-EGFP fusion. Archer1's red fluorescence monitors changes in membrane voltage.DepositorInsertArcher1-EGFP
UseLentiviralTagsEGFPExpressionMammalianPromoterCaMKIIaAvailable sinceNov. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HIRA-polyA
Plasmid#59781PurposeExpress H3.3 chaperone HIRA in mammalian cells (CMV promoter). Also suitable for in vitro transcription (T7 promoter) for injecting mRNA into oocytes.DepositorInsertHIRA
ExpressionMammalianPromoterCMV and T7Available sinceSept. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMU-ACTLr
Plasmid#61193PurposeFluorescent reporter for F-actin LifeAct-mCherry expressed under AtUBQ10 promoterDepositorInsertLifeAct-mCherry
TagsmCherryExpressionPlantPromoterAtUBQ10Available sinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by