We narrowed to 24,955 results for: LARS
-
Plasmid#218655PurposeKnockout vector for mouse Fam160b1 (Fhip2A)DepositorInsertFam160b1 (Fhip2a Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV UBC msNLRP3(LRRm5)-APEX2-3xFLAG-IRES-eGFP (H781E_Q782R_F785A)
Plasmid#218636PurposeProximity biotinylation of msNLRP3(LRRm5, H781E_Q782R_F785A)DepositorInsertNLRP3 (Nlrp3 Mouse)
UseLentiviralTagsAPEX2-3xFLAGExpressionMammalianMutationH781E, Q782R, F785APromoterUBCAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
MGS0156_pET29b
Plasmid#215410PurposeExpression construct for MGS0156 gene, codon optimized for expression in E. coliDepositorInsertMGS0156
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 2
Plasmid#207610PurposesgRNA 2 to knockout TR by replacement with a PuroR cassetteDepositorInsertTCAGGCCGCAGGAAGAGGAA
UseTagsNoneExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template
Plasmid#215000PurposeEndogenously tag mouse TMEM115 with a C-terminal 3xHA tag in addition to cytosolic mScarlet-I for cell sorting.DepositorInsertmsTMEM115-TEV-3C-P2A-mScarlet-I HDR Template (Tmem115 Mouse)
UseHdr templateTags3xHAExpressionMutationPromoterNoneAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28b-PunyEEER
Plasmid#208322PurposeBacterial expression of the His-tagged peptide PunyEEER.DepositorInsertPunyERRE
UseTagsDBCO-Tag, His-TagExpressionBacterialMutationPromoterAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK201
Plasmid#207131PurposeType 2 ptac promoter partDepositorInsertptac promoter
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM042_P15678_MultiGeneBackbone
Plasmid#216467PurposeEmpty integration vector for genomic integration for multigene into S. pombe. Targets Ura4 locus. Part type 15678 following the YeastToolkit MoClo grammar. Contains GFP drop out.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM041_P15678_SingleGeneBackbone
Plasmid#216466PurposeEmpty integration vector for genomic integration of 1 transcriptional unit into S. pombe. Targets Ura4 locus. Part type 15678 following the YeastToolkit MoClo grammar. Contains GFP drop out.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM032_P4_tSynth30
Plasmid#216457PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth30
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM031_P4_tSynth29
Plasmid#216456PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth29
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM030_P4_tSynth27
Plasmid#216455PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth27
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM029_P4_tSynth25
Plasmid#216454PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth25
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM028_P4_tSynth3
Plasmid#216453PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth3
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM027_P4_tSynthGuo
Plasmid#216452PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator guo
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM025_P2_pTUP11
Plasmid#216450PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter tup11
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM023_P2_pAPL4
Plasmid#216448PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter apl4
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM021_P2_pTUB1
Plasmid#216446PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter tub1
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM018_P2_pRPL701
Plasmid#216443PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter rpl701
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM017_P2_pTIF51
Plasmid#216442PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter tif51
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM016_P2_pRPL2501
Plasmid#216441PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter rpl2501
UseSynthetic BiologyTagsExpressionYeastMutationRemoval of any BsaI // BsmBI restriction sitePromoterAvailable sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 1
Plasmid#207609PurposesgRNA 1 to knockout TR by replacement with a PuroR cassetteDepositorInsertACCCTAACTGAGAAGGGCGT
UseTagsNoneExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT87
Plasmid#204489PurposeCAG promoted WBeta recombinaseDepositorInsertWBeta recombinase
UseSynthetic BiologyTagsExpressionBacterial and MammalianMutationPromoterCAGAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28b-TREER
Plasmid#208321PurposeBacterial expression of the His-tagged peptide TREER.DepositorInsertTREER
UseTagsDBCO-Tag, His-TagExpressionBacterialMutationPromoterAvailable sinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only