We narrowed to 9,829 results for: CAG
-
Plasmid#226193PurposeExpression mappingDepositorInsertSyn Barcode22
UseAAVAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWT055c
Plasmid#96876Purposetheophylline-agRNA-HEK3DepositorInserttheophylline-agRNA-HEK3
ExpressionMammalianAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
OgeuIscB GCA RNA
Plasmid#222864PurposeThis plasmid codes for the guide of the OgeuIscB with a GCA targetDepositorPublicationInsertOgeuIscB omega RNA with a (GCA)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available sinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
OgeuIscB AGC RNA
Plasmid#222866PurposeThis plasmid codes for the guide of the OgeuIscB with a AGC targetDepositorPublicationInsertOgeuIscB omega RNA with a (AGC)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available sinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pORE303N_CEN1
Plasmid#194439PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, knockout CEN1DepositorInsertgRNA targeting CEN1
UseCRISPRExpressionPlantPromoterMtU6Available sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
AA320
Plasmid#215952PurposeFragmid fragment: (guide cassette) guide expression; reverse orientation; positive control cell surfaceDepositorInsertrev{U6_v1; DR_v0 [EnAs]; sgCD47_v1 [EnAs]; DR_v1 [EnAs]; sgCD47_v2 [EnAs]}
UseCRISPR; FragmentAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgAGC-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222859PurposeThis plasmid codes for the Slug-KH nickase with a sg(AGC)6DepositorPublicationInsertSlug-KHD10A+sgAGC
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable sinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgGCA-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222860PurposeThis plasmid codes for the Slug-KH nickase with a sg(GCA)6DepositorPublicationInsertSlug-KHD10A+sgGCA
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable sinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7578 pHR (hU6-crPROX-EFS-PuroR-WPRE)
Plasmid#214882PurposeLentiviral vector encoding RfxCas13d targeting PROX guide arrayDepositorInserthU6-crPROX-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-26kb-DSF
Plasmid#227482Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 26kb Downstream Fgf5
UseCRISPRAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode19
Plasmid#226196PurposeExpression mappingDepositorInsertSyn Barcode19
UseAAVAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode21
Plasmid#226194PurposeExpression mappingDepositorInsertSyn Barcode21
UseAAVAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode18
Plasmid#226191PurposeExpression mappingDepositorInsertSyn Barcode18
UseAAVAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NQO1
Plasmid#214684PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human NQO1DepositorInsertdgRNA_NQO1 (NQO1 Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet-Seq1.1
Plasmid#201401PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/Col1a1/GFP4_Seq 1.1
Plasmid#201400PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only