We narrowed to 10,402 results for: plasmids 101
-
Plasmid#134127PurposeBacterial expression of human Ska1 microtubule binding domain (MTBD)DepositorAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pIW039
Plasmid#134126PurposeBacterial expression of human Ska1 microtubule binding domain (MTBD)DepositorInsertHis-Precission-human Ska1 MTBD (SKA1 Human)
ExpressionBacterialMutationaa 132-255 and K203A K206AAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIW028
Plasmid#134125PurposeBacterial expression of human Ska1 microtubule binding domain (MTBD)DepositorInsertHis-Precission-human Ska1 MTBD (SKA1 Human)
ExpressionBacterialMutationaa 132-255 and K183A K184AAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shNts2
Plasmid#132714PurposeEncodes short hairpin RNA (shRNA) #2 that targets the 3’-untranslated region of the rat NtsDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shNts1
Plasmid#132713PurposeEncodes short hairpin RNA (shRNA) #1 that targets the the 3’-untranslated region of the rat Nts geneDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4.13/GUG, AAA(30)-FFLuc-3XFLAG
Plasmid#127335PurposeExpress 3xFLAG tagged firefly luciferase (FFLuc) from GUG start codon (AUG at codon 30 mutated to AAA)DepositorInsertFirefly luciferase
Tags3xFLAGExpressionMammalianPromoterSV40Available SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/CUG-stop-nLuc-3XFLAG
Plasmid#127309PurposeExpress 3xFLAG tagged nanoLuciferase (nLuc) from CUG start codon, but translation terminated immediately by stop codonDepositorInsertnanoLuciferase
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/GUG-nLuc-3XFLAG-CL1/PEST
Plasmid#127317PurposeExpress 3xFLAG tagged highly destabilized nanoLuciferase (nLuc) protein from GUG start codonDepositorInsertnanoLuciferase
Tags3xFLAG and CL1/PESTExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/CUG-nLuc-3XFLAG-PEST
Plasmid#127313PurposeExpress 3xFLAG tagged destabilized nanoLuciferase (nLuc) protein from CUG start codonDepositorInsertnanoLuciferase
Tags3xFLAG and PESTExpressionMammalianPromoterCMVAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/AUU-nLuc-3XFLAG-CL1/PEST
Plasmid#127319PurposeExpress 3xFLAG tagged highly destabilized nanoLuciferase (nLuc) protein from AUU start codonDepositorInsertnanoLuciferase
Tags3xFLAG and CL1/PESTExpressionMammalianPromoterCMVAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/GGG-stop-nLuc-3XFLAG
Plasmid#127311PurposeExpress 3xFLAG tagged nanoLuciferase (nLuc) from negative control GGG start codon, but translation terminated immediately by stop codonDepositorInsertnanoLuciferase
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/AAA-stop-nLuc-3XFLAG
Plasmid#127310PurposeExpress 3xFLAG tagged nanoLuciferase (nLuc) from negative control AAA start codon, but translation terminated immediately by stop codonDepositorInsertnanoLuciferase
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/BAG1 5′ UTR AUG-nLuc-3xFLAG
Plasmid#127329PurposeExpress 3xFLAG tagged nanoLuciferase (nLuc) from AUG start codon from mRNA with BAG1 5' UTRDepositorInsertnanoLuciferase
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/BAG1 5′ UTR CUG-nLuc-3xFLAG
Plasmid#127328PurposeExpress 3xFLAG tagged nanoLuciferase (nLuc) from CUG start codon from mRNA with BAG1 5' UTRDepositorInsertnanoLuciferase
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pGL2-MCT2Prom2.5
Plasmid#87351PurposeHuman monocarboxylate transporter 2 (MCT2) promoter 2.5 kbpDepositorInsertMCT2 (SLC16A7 Human)
UseLuciferaseExpressionBacterial and MammalianPromoter2.5 kbp proximal promoter of human MCT2 (nested d…Available SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL2-MCT2Prom1.1
Plasmid#87352PurposeHuman monocarboxylate transporter 2 (MCT2) promoter 1.1 kbpDepositorInsertMCT2 (SLC16A7 Human)
UseLuciferaseExpressionBacterial and MammalianPromoter1.1 kbp proximal promoter of human MCT2 (nested d…Available SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL2-MCT2Prom3.2
Plasmid#87349PurposeHuman monocarboxylate transporter 2 (MCT2) promoter 3.2 kbpDepositorInsertMCT2 (SLC16A7 Human)
UseLuciferaseExpressionBacterial and MammalianPromoter3.2 kbp proximal promoter of MCT2 (nested deletio…Available SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only