We narrowed to 5,468 results for: pAAV
-
Plasmid#176281PurposeViral vector for co-expression of non-functional NaChBac and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertmNaChBacMUT-P2A-EGFP
UseAAV and Cre/LoxExpressionMammalianMutationE191KPromoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ADAR2-2a-Fezf2 sesRNA-2a-tTA2-WPRE
Plasmid#239027PurposeExpression of ADAR2, sesRNA in mammalian cells with hSyn promoter, with tTA2 as efRNA and ADAR2 overexpression.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1774 - pAAV-AiE2449m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214540PurposeAiE2449m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pM125: pAAV-EFS-CasRx-VEGFA array presgRNA
Plasmid#166873PurposeAAV vector for expressing CasRx and human VEGFA targeting presgRNA array for RNA-editingDepositorInsertsU6-VEGFA array presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianPromoterEFS and U6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Camk2a(0.4)-DIO-Opto-cytTrkB(E281A)-HA
Plasmid#180588PurposeOpto-cytTrkBDepositorInsertTrkB
UseAAVMutationPHR(E281A)Available SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
LZF1735 pAAV_hSyn-DiO-somArchon1-EGFP-P2A-somCheRiff
Plasmid#126512PurposeOptopatch4. Simultaneous optical recording and manipulation of electrical activity in neuronsDepositorInsertsomArchon1-EGFP-P2A-somCheRiff
UseAAVExpressionMammalianAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
AiP1788 - pAAV-AiE2116m-minBG-iCre(R297T)-BGHpA
Plasmid#220713PurposeAiE2116m is an enhancer sequence, designed to induce cre-dependent recombination in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVPromoterminBGAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorInsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1078-pAAV-mscRE16-minBGpromoter-oNigri-WPRE-hGHpA
Plasmid#163490PurposeDirect-expressing oNigri AAV Virus. Alias: AiP1078 - pAAV-AiE2016m-minBG-oNigri-WPRE-HGHpADepositorInsertoNigri
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only