We narrowed to 16,103 results for: grna
-
-
-
-
-
-
-
-
-
-
-
pUDP002
Plasmid#103872PurposeBroad-host-range Cas9/gRNA co-expression backbone plasmid (no gRNA)DepositorInsertshph
Spcas9 D147Y P411T
UseCRISPRTagsNLSExpressionYeastMutationD147Y P411TPromoterArxula adeninivorans TEF1 and Ashbya gossypii (Er…Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB-US-ECasE
Plasmid#83961PurposePiggyac transposon containing tamoxifen inducible Cas9 and a gRNA cassette.DepositorInsertERT2-spCas9-ERT2
ExpressionMammalianMutationplease see depositor comments belowPromoterU6 (gRNA), EF1a (ERT2-Cas9-ERT2)Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 sgAAVS1
Plasmid#127099PurposeEncodes gRNA for human AAVS1.DepositorAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NQO1
Plasmid#214684PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human NQO1DepositorInsertdgRNA_NQO1 (NQO1 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-As
Plasmid#86196PurposeAsCpf1 gRNA entry plasmid using Zea mays Ubi promoter and ribozyme processingDepositorInsertAsCpf1 gRNA cloning site for ribozyme cleavage
UseCRISPRTagsHammerhead ribozyme and HDV ribozymeExpressionPlantPromoterMaize ubiquitin 1Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -