We narrowed to 6,763 results for: poly
-
Plasmid#203585PurposeExpresses V5-tagged mutant version of EZH1 partially resistant to JQ-EZ-05 in mammalian cells.DepositorInsertEZH1 (EZH1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationchanged Aspartic Acid 745 to Asparagine for parti…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTW5126
Plasmid#129732Purposepolyhistidine replacement of EatA passenger DUF corresponding to amino acids E541 -Q617 of the native EatA proteinDepositorInserteatA-DUF::His8
Tags9His tagExpressionBacterialMutationreplaces the domain of unknown function correspon…PromoteraraBADAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG1b_nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169162PurposeBaculoviral transfer vector to express SARS-CoV-2 nsp10 in insect cellsDepositorInsertnsp10-6His-3xFlag (ORF1ab SARS-CoV-2, Synthetic)
Tags6His-3xFlagExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_3xFlag-6His-nsp14 (SARS-CoV-2)
Plasmid#169163PurposeBaculoviral transfer vector to express SARS-CoV-2 nsp14 in insect cellsDepositorInsert3xFlag-6His-nsp14 (ORF1ab SARS-CoV-2, Synthetic)
Tags3xFlag-6HisExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shGLS
Plasmid#110335PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene, puromycin selectionDepositorInsertGLS glutaminase (GLS Synthetic, Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic-ME.2/ApoEpromoter
Plasmid#51436PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancerDepositorUseLuciferaseExpressionMammalianMutationThe ME.2 enhancer is fused upstream of the ApoE g…Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pZ M2rtTA_CAGG TetON-Sox10 with GFP
Plasmid#115241PurposeRMCE donor vector for inducible expression of SOX10 and GFP and constitutive expression of m2rtTA (generated from plasmid #112668)DepositorAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PDGFRB
Plasmid#23893DepositorInsertPDGFRB (PDGFRB Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
pAB2076 pAAV REPAIR.t1
Plasmid#176323PurposepAAV EFS-HIVNES-dCas13bt1- (GGS)2-huADAR2(E488Q)-3xHA BGHpolyA::U6-BpiI-Cas13bt1 DR (full REPAIR.t1 + crRNA expression for AAV production)DepositorInsertshuman codon optimized Cas13bt1 (catalytically inactivated)
huADAR2dd(E488Q) (ADARB1 Human)
Cas13bt1 crRNA + BpiI cloning site
UseAAV and CRISPRTags3xHA and HIV NESExpressionMammalianMutationE488Q, only the deaminase domain (aa 276-702 are …PromoterEFS (short EF1alpha) and hU6Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PDGFRA
Plasmid#23892DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OSK
Plasmid#136552PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Sox2, Klf4DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CSNK2A1
Plasmid#23678DepositorInsertCSNK2A1 (CSNK2A1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAd-M3cherry
Plasmid#61041PurposeThis plasmid mediates polycistronic expression of 4 genes: Ngn3, Pdx1, Mafa, and mCherry. It can be used to convert mouse pancreatic acinar cells to induced beta-like cells in vivo.DepositorAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-Puro-PNPT1 S484A
Plasmid#223316PurposeLentiviral vector expressing human PNPT1 S484A variantDepositorInsertPolyribonucleotide Nucleotidyltransferase 1 (PNPT1 Human)
UseLentiviralExpressionMammalianMutationChanged serine 484 to alanineAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CSNK2B
Plasmid#23359DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PIK3CA
Plasmid#23466DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE3 (minus strand)
Plasmid#91845PurposeLuciferase reporter for CD69 enhancer (IGI-P0622)DepositorInsertCD69 CaRE3 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationMissing 1 base from 13 base polyT tract beginning…Available SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SKM
Plasmid#136551PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Sox2, Klf4, cMycDepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only