We narrowed to 20,436 results for: ACE
-
Plasmid#66010PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [F:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_GB
Plasmid#66011PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [G:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZS1[GalS-L,LacI-L]
Plasmid#60759PurposeContains PIq driving expression GalS-L, and PI driving expression of LacI-L.DepositorInsertsGalS-L
wt LacI
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. LacI DBD with GalS L…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pzs1[GalS-L]
Plasmid#60743PurposeContains PIq driving expression of GalS-R, the Fucose inducible chimera with the wt Lac DBD.DepositorInsertGalS-L
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. LacI DBD with GalS L…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[RbsR-T]
Plasmid#60751PurposeContains PIq driving expression RbsR-T, the Ribose inducible chimera with the TAN DBD.DepositorInsertRbsR-T
UseSynthetic BiologyExpressionBacterialMutationChimeric LacI/GalR repressor with the TAN DBD and…Available SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[RbsR-L]
Plasmid#60741PurposeContains PIq driving expression RbsR-L, the Ribose inducible chimera with the wt Lac DBD.DepositorInsertRbsR-L
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. LacI DBD with RbsR L…Available SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d23
Plasmid#59892Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with two seed sites mutatedDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd and fourth seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d3
Plasmid#59891Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with one seed site mutated.DepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
5mARF17 pBluescript
Plasmid#12069DepositorInsert5mARF17 (ARF17 Mustard Weed)
ExpressionBacterialMutationmiR160-resistant version of ARF17 has five silent…Available SinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAV10
Plasmid#63213PurposepUC19 backbone (Amp), contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. NotI or FseI sites for TU digest.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
pPKm-292
Plasmid#105816PurposepcDNA - GAL4 DBD - MTAD. Expresses Gal4 DNA binding domain fused to MTADDepositorInsertGAL4 DBD and MTAD
ExpressionMammalianPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
HsB2AR-mCherry
Plasmid#137785PurposeVisualization of the Beta-2-adrenergic receptorDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a6
Plasmid#124847PurposeMutagenesis of Slc17a6 with SauCas9DepositorInsertSlc17a6 gRNA (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-LMNB1
Plasmid#207770PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of LMNB1 for knock-in.DepositorInsertsgRNA Targeting N-terminus of LMNB1 (LMNB1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
Fyn-Fyn Biosensor
Plasmid#124655PurposeFRET biosensor. Fyn-tagged biosensor targeting to membraneDepositorInsertSynthetic gene containing ECFP-SH2 domain-substrate-linker-YPet
ExpressionMammalianAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE7.10
Plasmid#102919Purposeexpresses ABE7.10 in mammalian cellsDepositorInsertABE7.10
TagsNLSExpressionMammalianMutationsee manuscriptPromoterCMVAvailable SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV-O-GECO1
Plasmid#46025PurposeOrange intensiometric genetically encoded Ca2+-indicators for optical imagingDepositorInsertO-GECO1
ExpressionMammalianMutationR-GECO1 N45I/A73V/S142P/M146R/M223T/M339L/K378R/E…PromoterCMVAvailable SinceJuly 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
GalT-RpHLuorin2
Plasmid#171719PurposeTrans-Golgi expression of ratiometric pHLuorin2DepositorInsertRatiometric pHLuorin2 fused to B4GALT1 (B4GALT1 Human)
Tagsratiometric pHluorin2ExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPD0029_pIVTRup(BsmBI)_SpCas9
Plasmid#242535PurposeIVTDepositorInsertSpCas9
UseCRISPRAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only