We narrowed to 10,769 results for: ESP

#14610

Matija Peterlin

Fujinaga et al Proc Natl Acad Sci U S A. 1999 Feb 16. 9

June 30, 2008

Academic Institutions and Nonprofits only

#108545

Cloning vector including N-terminally 3xFLAG-tagged Arabidopsis auxin receptor TIR1 [Wild type] and NOS terminator

Keiko Torii

Uchida et al Nat Chem Biol. 2018 Mar;14(3):299-305. d

May 9, 2018

Academic Institutions and Nonprofits only

#106102

CRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2

Thomas Tuschl

Meyer et al Mol Cell. 2018 Feb 15;69(4):622-635.e6.

Feb. 12, 2018

Academic Institutions and Nonprofits only

#106101

CRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF1

Thomas Tuschl

Meyer et al Mol Cell. 2018 Feb 15;69(4):622-635.e6.

Feb. 12, 2018

Academic Institutions and Nonprofits only

#87392

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87395

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87401

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#247000

This pFRT-B plasmid enables the creation of a stable mammalian cell line expressing RFP-tagged PCNA .

Cristina Cardoso

Chagin et al Nat Commun. 2016 Apr 7;7:11231. doi: 10.

April 7, 2026

Academic Institutions and Nonprofits only

#247001

This pFRT-B plasmid enables the creation of a stable mammalian cell line expressing GFP-tagged PCNA

Cristina Cardoso

Chagin et al Nat Commun. 2016 Apr 7;7:11231. doi: 10.

April 7, 2026

Academic Institutions and Nonprofits only

#250495

2.6 kb muscle enhancer derived from marine Salmon River, BC stickleback driving GFP expression

David Kingsley

Yoxsimer et al Curr Biol. 2026 Apr 6;36(7):1748-1763.e7

March 23, 2026

Academic Institutions and Nonprofits only

#247924

Insect expression construct for N-terminal His-GFP-tagged RAD54L2

Junjie Chen, Huimin Zhang

Zhang et al Sci Adv. 2023 Dec 8;9(49):eadi6681. doi:

Dec. 9, 2025

Academic Institutions and Nonprofits only