172,546 results
-
Plasmid#98962PurposeMammalian expression plasmid for CRISPR gRNA targeting human CXCR4 exon 2DepositorInsertCXCR4 (CXCR4 Human)
UseCRISPRExpressionMammalianMutationEncodes a gRNA for CRISPR-mediated targeting of C…PromoterU6Available SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaKKHABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189923PurposeAAV genome encoding SaKKHABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationnSaCas9 KKH, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTriExRhoA2G
Plasmid#40176DepositorInsertRhoA Biosensor
TagsHis-MycExpressionBacterial, Insect, and Mamm…PromoterCMVAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-Flag-Timeless
Plasmid#22887DepositorInsertTimeless (TIMELESS Human)
TagsFlagExpressionMammalianMutationdeleted normal start codon, replaced with start c…Available SinceJan. 28, 2010AvailabilityAcademic Institutions and Nonprofits only -
wtBxb1
Plasmid#222337PurposePlasmid for expressing wild type Bxb1 in mammalian cellsDepositorInsertCodon-optimized wild type Bxb1
ExpressionMammalianPromoterCMVAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSens-4OmeNB
Plasmid#216231PurposeExpresses GFP in response to 4'-O-MethylnorbelladineDepositorInsertsRamR-4NB2
sfGFP
UseSynthetic BiologyMutationK64T, L67M, C135D, S138GPromoterJ23103 and PramrAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJ151-HDR
Plasmid#113631PurposeContains two recombination homology arms and loxP-flanked cassette encoding puromycin resistance gene, Venus fluorescence marker, thymidine kinase suicide gene, for scarless chromosomal engineering.DepositorInsertsLeft homology arm
Puromycin resistance gene
Venus fluorescence gene
Thymidine kinase
Right homology arm
UseCre/Lox; Homology recombination selection vectorExpressionBacterial and MammalianPromoterEF1a promoter, EF1a promoter (T2A cleaving sequen…Available SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-NGR-WPRE
Plasmid#234438PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorHas ServiceAAV1InsertiGluSnFR4f-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
HDM_VSV_G
Plasmid#204156PurposeVSV-G expression plasmidDepositorInsertVSV-G
ExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ultra-Exon1Q23-Myc-A
Plasmid#110486PurposeLentiviral vector to express wild-type N terminal HTT gene with short 3'UTR in mammalian cells (encodes Myc-tagged wild type huntingtin exon1 fragment with 23 repeats of Q)DepositorInsertHomo sapiens huntingtin (HTT Human)
UseLentiviralTagsMycExpressionMammalianMutationShort 3'UTR wild type huntingtin exon1 fragm…PromoterUbCAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/T0-Flag-CIP2A
Plasmid#222623Purposemammalian expression vector of Flag-tagged CIP2ADepositorAvailable SinceJuly 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-AID-PcrA-UGI
Plasmid#221220PurposeExpress HACE Editor as a fusion of AID cytidine deaminase and PcrA helicase.DepositorInsertAID-PcrA-UGI
ExpressionMammalianAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcs2-ATF4uORF1-2-GFP-IRES-mCherry
Plasmid#226105PurposeATF4uORF1-2 stability reporter construct with deletion of SIFI degron helices 1&2 for transient expression in mammalian cells to read out activation of the integrated stress response (ISR)DepositorInsertatf4 (ATF4 Human)
TagsGFPExpressionMammalianMutationcontains uORF1-2 of ATF4, whose stability can ser…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti SpBsmBI sgRNA Hygro
Plasmid#62205PurposeAn empty sgRNA expression vector for expression of sgRNA for Sp Cas9DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6Available SinceNov. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
BC1177-pHR-SFFV-GFP(1-10)-NLS
Plasmid#164039PurposeExpression of GFP1-10 in mammalian cellsDepositorInsertGFP(1-10)
UseLentiviralExpressionMammalianPromoterSFFVAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSET-6xTR-TUBE
Plasmid#110313PurposeE. coli expression and purification of 6xTR-TUBEDepositorInsert6xTR-TUBE (UBQLN1 Human)
TagsN-terminal His6-T7 tagExpressionBacterialMutationAll Arg residues in the UBA domain are mutated to…PromoterT7Available SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAd5-B6 ∆E3-GFP
Plasmid#179201PurposeBlock 6 with deletion in E3 and insertion of GFP expression cassetteDepositorInsertModified block 6, with deletion in E3 and insertion of GFP expression cassette
UseAdenoviralAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Vimentin-pLJM5
Plasmid#189868PurposeExpresses human Vimentin in mammalian cellsDepositorInsertVimentin
Tagsm-CherryExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-GOLGA2
Plasmid#207791PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of GOLGA2 for knock-in.DepositorInsertsgRNA Targeting N-terminus of GOLGA2 (GOLGA2 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only