We narrowed to 2,288 results for: ung
-
Plasmid#78267PurposeExpress HyPer-AS sensor that change excitation wavelength with the presence of hydrogen peroxide.DepositorInsertMoHyper
UseExpress in magnaportheExpressionYeastPromoterRp27Available sinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pYFAC-CH2-ubi-Y-pyrG
Plasmid#221131PurposeExpression of heterologous genes under alcohol induction optimised with ubi-Y-pyrG marker. Promoters PalcA-T1-PalcS/M-T2-PaldA expression cassette; unique restriction sites: PacI, NotI, AsiSI, AscI.DepositorTypeEmpty backboneUseSynthetic Biology; Expression in aspergillus and …PromoterPalcA-T1-PalcS/M-T2-PaldA expression cassette (al…Available sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFGL1079
Plasmid#116897PurposeCenpC:eGFP (centromere marker)DepositorInsertsCenp C (partial)
eGFP
CenpC downstream region
UseFungal expression (in magnaporthe oryzae)Mutationtruncated, no stop codon and without start codonAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ 2xFLAG-2xSTREP_BACH1_Y11F
Plasmid#159132PurposeExpresses BACH1 in mammalian cellsDepositorAvailable sinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX-EF1a_NKX2-1_Long
Plasmid#221483PurposeNKX2-1 long isoform lentiviral overexpressionDepositorAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEK36
Plasmid#210598PurposeReporter gene expression in B. dendrobatidisDepositorInsertSpH2Bpro-Hshph-G4S-HsmClover3-ScADH1ter
TagsmClover3ExpressionBacterial and YeastPromoterSpH2BproAvailable sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-tetON-NOTUM-EF1a-TagRFP-2A-tet3G
Plasmid#204188PurposeDoxycycline inducible lentiviral vector for human NOTUM overexpressionDepositorAvailable sinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2.1-NLS(sv40) (BPK5059)
Plasmid#115137PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2.1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBabe hygro NFS1
Plasmid#102977PurposeExpression of NFS1DepositorInsertNFS1 (NFS1 Human)
UseRetroviralExpressionMammalianMutationSilent mutations to eliminate shNFS1_1 binding si…Available sinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
VC388
Plasmid#49958PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX 4T1 ERbeta(1-255)
Plasmid#35564DepositorAvailable sinceMarch 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRI018-pKW20088-PelcA-mCherry-TtrpC-PU3-E1-Cas9Scaffold-8xT
Plasmid#140205PurposeProof-of-concept of CRISPR/dSpCas9-VPR activation, encoding PelcA-mCherry along with the sgRNA E1 expression cassette, targeting PelcA.DepositorInsertsmCherry
sgRNA E1
UseCRISPR and Synthetic Biology; Proof-of-concept te…MutationG174DPromoterPelcA and U3Available sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBp-FGFR2b-K660E
Plasmid#45705DepositorPublicationAvailable sinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX 4T1 ERbeta(144-255)
Plasmid#35565DepositorAvailable sinceMarch 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKM263-EcPPXc
Plasmid#38328DepositorInsertE. coli polyphosphatase (ppx Escherichia coli)
Tags6xHIS, GST, and TEVExpressionBacterialMutationC-terminus of E. coli polyphosphatase (described …PromoterT7Available sinceAug. 2, 2012AvailabilityAcademic Institutions and Nonprofits only