We narrowed to 14,178 results for: cas9
-
Plasmid#90623Purpose3rd generation lentiviral gRNA plasmid targeting human CEP55DepositorInsertCEP55 (Guide Designation B12.2)
UseCRISPR and LentiviralPromoterU6Available SinceNov. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
FOXM1 C11.2 gRNA
Plasmid#90690Purpose3rd generation lentiviral gRNA plasmid targeting human FOXM1DepositorInsertFOXM1 (Guide Designation C11.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
ANLN A2.2 gRNA
Plasmid#90531Purpose3rd generation lentiviral gRNA plasmid targeting human ANLNDepositorInsertANLN (Guide Designation A2.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F1.3 gRNA
Plasmid#90652Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CEP55 B11.2 gRNA
Plasmid#90622Purpose3rd generation lentiviral gRNA plasmid targeting human CEP55DepositorInsertCEP55 (Guide Designation B11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
FEN1 C10.3 gRNA
Plasmid#90689Purpose3rd generation lentiviral gRNA plasmid targeting human FEN1DepositorInsertFEN1 (Guide Designation C10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
VCP F12.4 gRNA
Plasmid#90939Purpose3rd generation lentiviral gRNA plasmid targeting human VCPDepositorInsertVCP (Guide Designation F12.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
VCP F11.4 gRNA
Plasmid#90938Purpose3rd generation lentiviral gRNA plasmid targeting human VCPDepositorInsertVCP (Guide Designation F11.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS443-pCSDest2-AcrIIC3Nme
Plasmid#85713PurposeMammalian expression of Type II-C anti-CRISPR protein AcrIIC3Nme from Neisseria meningitidisDepositorInsertType II-C anti-CRISPR AcrIIC3Nme
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA2
Plasmid#68465Purposetargeting PAX6 geneDepositorAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMDlg/pRRE-int-MS2M
Plasmid#166032PurposeExpression of bacteriophage-derived MS2 coat protein fused HIV-1 Lentiviral Gag-Pol at C terminal with a HIV-1 protease cleavage signal between MS2 and Gag-Pol.DepositorInsertGag-Pol-MS2
UseLentiviralMutationD64V mutation within the integrase within PolAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWR63
Plasmid#203331Purposeepisomal Cas9 and sgRNA expression vector without sgRNA for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
UseCRISPRExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
JME5000
Plasmid#129661PurposeEYK1ex_CrisprCas9-yl_RFP: CAS9 vector with EYK1ex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSPneoSagRNAH
Plasmid#123265PurposeExpresses gRNA of Staphylococcus aureus Cas9 (SaCas9) in LeishmaniaDepositorTypeEmpty backboneUseCRISPR; Leishmania expressionAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNeoSagRNAH
Plasmid#123266PurposeExpresses gRNA of Staphylococcus aureus Cas9 (SaCas9) in LeishmaniaDepositorTypeEmpty backboneUseCRISPR; Leishmania expressionAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pJB172
Plasmid#86992PurposeCRISPR/Cas9 in fission yeast using fluoride selection and targetting pil1DepositorInsertgRNA targeting pil1
ExpressionYeastAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for2
Plasmid#81209Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJAT56
Plasmid#204300PurposeExpress phiC31 under control of D. melanoagaster vasa promoter, with Vasa 3’UTR.DepositorInsert3XP3-EGFP
UseCRISPRPromoter3XP3Available SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only