We narrowed to 10,419 results for: plasmids 101
-
Plasmid#216171PurposeExpress the gRNA targeting the PRDM1-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dyn1 R271E
Plasmid#198343PurposeMammalian expression plasmid of GFP-chimera proteins.DepositorAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dyn1 K44A
Plasmid#198340PurposeMammalian expression plasmid of GFP-chimera proteins.DepositorAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dyn1 D406A
Plasmid#198341PurposeMammalian expression plasmid of GFP-chimera proteins.DepositorAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xKBstTyrT(CUA)_EF1_sfGFP 102TAG 150TAA
Plasmid#174895Purposeamber and ochre dual suppression reporter sfGFP 102TAG 150 TAA expression, with BstTyr(CUA) amber suppressor tRNA cassetteDepositorInsertsfGFP
ExpressionMammalianMutation102TAG 150TAA in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
miR5 HsATP10B
Plasmid#204481Purposetransfer plasmid for lentiviral vector production with miR for Hs ATP10BDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(103)-GFP
Plasmid#197890PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(553)-GFP
Plasmid#197888PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(285)-GFP
Plasmid#197889PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
MEN2A-MAC
Plasmid#139634PurposeMAC-tagged gene expressionDepositorAvailable SinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Rictor-g1)-PGKpuroBFP-W
Plasmid#105041PurposeLentiviral gRNA plasmid targeting mouse Rictor , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Rictor-g2)-PGKpuroBFP-W
Plasmid#105042PurposeLentiviral gRNA plasmid targeting mouse Rictor , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Tcf7l1-g1)-PGKpuroBFP-W
Plasmid#105015PurposeLentiviral gRNA plasmid targeting mouse Tcf7l1 , co-expression of TagBFPDepositorInsertgRNA targeting Tcf7l1 (Tcf7l1 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-