We narrowed to 7,667 results for: PAC
-
Plasmid#231907PurposeFor packaging EGFP, dTomato and TagBFP mRNA into SARS-CoV-2 virus-like particles (VLPs)DepositorInsertEGFP-P2A-dTomato-T2A-TagBFP
ExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Const.4 EGFP-IRES-Luc-PS9
Plasmid#231908PurposeFor packaging EGFP and firefly luciferase mRNA into SARS-CoV-2 virus-like particles (VLPs)DepositorInsertEGFP-IRES-Luc
ExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-APOBEC1-EGFP
Plasmid#209324PurposeAAV packaging vector containing a APOBEC1 expression, a P2A-EGFP expression cassette.DepositorInsertAPOBEC1-HA
UseAAVTagsHAAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
LVDP 2P.2.EGFP
Plasmid#231905PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '2-plasmid' system and packaging EGFP mRNA into the VLPsDepositorUseLentiviralMutationR203M in N proteinPromoterCMV, EF-1aAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV299
Plasmid#204967PurposeAMA1 plasmid with Aspergillus optimized Mad7 and argB selection markerDepositorInsertsMad7
argB
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and native pro…Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-2xMS2
Plasmid#212627PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-2xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-12xMS2
Plasmid#212628PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-12xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSN539
Plasmid#226775PurposeExpresses Drosophila UNC-104(wild-type) in insect cellsDepositorAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKC51
Plasmid#226779PurposeExpresses Drosophila UNC-104(A255V) in insect cellsDepositorInsertDrosophila unc-104 (A255V) (unc-104 Fly)
TagssfGFP and 2xStrepIIExpressionInsectMutationchanged Alanine 255 to ValineAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR120
Plasmid#185041PurposeJ23108 promoter, l31 5'UTR, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationOnly first 90 nt of rpmE coding presentAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ121-Split-TALED
Plasmid#218171PurposeExpress plastid TALE-linked deaminases (TALED), composed of TALE, split DddA originated from Burkholderia cenocepacia, and an engineered deoxyadenosine deaminase derived from the E. coli TadA proteinDepositorInsertTALE-Intron-N-DddAtox half (G1397N)-T2A-TALE-C-DddAtox half (G1397C)-TadA8e
UsePlastid base editingExpressionPlantAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-APOBEC1-YTH-EGFP
Plasmid#209322PurposeAAV packaging vector containing a APOBEC1-YTH expression, a P2A-EGFP expression cassette,.DepositorInsertAPOBEC1-YTH-HA
UseAAVTagsHAAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EGFP-APOBEC1-YTH
Plasmid#209319PurposeAAV packaging vector containing a EGFP-P2A expression cassette, APOBEC1-YTH cassette.DepositorInsertAPOBEC1-YTH-HA
UseAAVTagsHAAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
SiRES COR1C DCC-GFP
Plasmid#195149Purposeimage COR1CDepositorInsertCORO1C (CORO1C Human)
ExpressionMammalianMutationmutations to make si RNA resistant and remove coi…Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
SiRES COR1C ACT--GFP
Plasmid#195151Purposeimage COR1CDepositorInsertCORO1C (CORO1C Human)
ExpressionMammalianMutationmutations to make si RNA resistant and remove act…Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCitro-15a
Plasmid#202033Purposep15a-based plasmid that encodes a conjugative system synthesized from metagenomic data for conjugation to CitrobacterDepositorInsertconjugative system from a Citrobacter spp.
UseSynthetic BiologyAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpG-DmXRN1_1323-1355_P
Plasmid#147245PurposeBacterial Expression of DmXRN1_1323-1355DepositorInsertDmXRN1_1323-1355 (pcm Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_motif_scram
Plasmid#149397PurposeP. aeruginosa PA14 CRISPR2 locus, with a scrambled Upstream recognition motifDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutationUpstream motif recognized by Cas1-2/3 during spac…PromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only