We narrowed to 10,132 results for: yeast
-
Plasmid#213785PurposeIntegrates at the CAN1 locus the BadBoy2 TP-DNAP1 variant and the Nourseothricin resistance marker. Includes an I-SceI transient expression cassette.DepositorInsertBadBoy2 TP-DNAP1
UseSynthetic BiologyExpressionYeastAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-Kar2-Beta-Amyloid
Plasmid#181707PurposeGalactose inducible expression of Kar2-Beta-AmyloidDepositorInsertKar2-Beta-Amyloid
ExpressionYeastAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp204-PADH1-AFB2
Plasmid#99531PurposeS. cerevisiae expression of F-box protein AFB2 under control of the ADH1 promoter, TRP1 marker (for use with the AID degron system)DepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS303-PADH1-AFB2
Plasmid#99530PurposeS. cerevisiae expression of F-box protein AFB2 under control of the ADH1 promoter, HIS3 marker (for use with the AID degron system)DepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHflu4
Plasmid#203882PurposepHI1 with insertion of monomeric red fluorescent protein (mRFP)DepositorInsertmonomeric red fluorescent protein
UseSynthetic BiologyExpressionBacterial and YeastAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBHM2641
Plasmid#229525PurposeCarries OsTIR1-t2a-mNG-AID*, used to insert TIR1 expressing construct into the C. neoformans genome.DepositorInsertOsTIR1
UseCRISPRTagst2a-mNeonGreen-AID*ExpressionBacterial and YeastMutationF74GPromoterTEF1Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2647
Plasmid#229989PurposeCarries OsTIR1-t2a-mNG-mIAA7, used to insert TIR1 expressing construct into the C. neoformans genome.DepositorInsertOsTIR1
Tagst2a-mNeonGreen-mIAA7_optExpressionBacterial and YeastMutationF74GAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2648
Plasmid#229990PurposeCarries OsTIR1-t2a-mNG-mIAA7, used to insert TIR1 expressing construct into the C. neoformans genome.DepositorInsertOsTIR1
Tagst2a-mNeonGreen-mIAA7_optExpressionBacterial and YeastMutationF74GAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2649
Plasmid#229991PurposeCarries OsTIR1-t2a-mNG-mIAA7, used to insert TIR1 expressing construct into the C. neoformans genome.DepositorInsertOsTIR1
Tagst2a-mNeonGreen-mIAA7_optExpressionBacterial and YeastMutationF74GAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
LHP2691 - pET30-Ub-K63A
Plasmid#32179DepositorTagsHISExpressionBacterialMutationK63APromoterT7Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
LHP2690 - pET30-Ub-K48A
Plasmid#32178DepositorTagsHISExpressionBacterialMutationK48APromoterT7Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
STK25
Plasmid#39075PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-TAF15
Plasmid#181713PurposeGalactose inducible expression of TAF15DepositorInsertTAF15 (TAF15 Human)
ExpressionYeastAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-24a-STE2
Plasmid#133430PurposeYeast STE2 coding sequence in vector for in vitro transcription and protein synthesis, with T7 promoter.DepositorInsertSTE2 (STE2 Budding Yeast)
ExpressionBacterialMutationBoth native Cys (C59S/C252A) have been mutated. S…Available SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXP420 v2 (repaired Amp promoter)
Plasmid#86920PurposeShuttle vector to facilitate gene expression for metabolic engineering in S. cerevisiae. Contains TEF1 promoter and CYC1 terminator for insertion of gene of interest. Contains HIS3 selection marker.DepositorTypeEmpty backboneUseCre/LoxExpressionYeastPromoterTEF1Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJK369
Plasmid#73594PurposeEncodes Crepis alpina delta-12 fatty acid acetylenase (vFAD2) with C-terminal FLAG epitopeDepositorInsertdelta-12 fatty acid acetylenase
TagsFLAG tagExpressionYeastPromoterGAL10Available SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-Kar2-moxGFP2-HDEL
Plasmid#218970PurposeGene replacement plasmid to label S. cerevisiae Kar2 with moxGFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only