We narrowed to 10,162 results for: tre promoter
-
Plasmid#72916PurposeRhodopsin promoter from chicken (Gallus gallus) gDNA chr12:19,499,638–19,501,514 in galGal4 driving DsRedDepositorInsertchicken rhodopsin (RHO Chicken)
PromoterrhodopsinAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pFSW Syt1-C2B D363,365N IRES GFP
Plasmid#133822PurposeEncodes the C2B domain of synaptotagmin 1 with calcium-coordinating ligand mutations D363,365N for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationD363,365NPromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A D230,232N IRES GFP
Plasmid#133824PurposeEncodes the C2A domain of synaptotagmin 1 with calcium-coordinating ligand mutations D230,232N for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationD230,232NPromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pYSD313
Plasmid#212931PurposeEncodes the Aga2 signal peptide, mRuby2 fluorescent protein HA-tagged Sed1p yeast surface display anchor protein with pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertSed1 (SED1 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
hRad51(S208E-A209D)–Cas9(D10A)
Plasmid#125561PurposeExpresses the hRad51(S208E-A209D)–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAD-LyseR (in lacZ deficient strain)
Plasmid#99245PurposeFor autolysate production in lacZ deficient (lac operon deletion) E. coli BL21-Gold-dLac (DE3) strain: constitutively expresses phage lambda endolysin (gene R)DepositorAvailable SinceOct. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-mir144 EF1Alpha-puro-T2A-BFP
Plasmid#164791PurposeExpress miR-144 under the U6 promoter in mammalian cellsDepositorInsertsUseLentiviralExpressionMammalianPromoterEF1Alpha and U6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_multi1-3-MS2-Puro
Plasmid#192683PurposeLentiviral expression of multi gNAs targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNAs #1,2,3 (MYOD1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
hRad51(A190L-A192L)–Cas9(D10A)
Plasmid#125562PurposeExpresses the Rad51(A190L-A192L)–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOPINF AtMKK5
Plasmid#228396PurposeRecombinant expression of His6-tagged Arabidopsis thaliana MKK5 in E. coliDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREMI-ZA
Plasmid#183736PurposePlasmid for a restriction enzyme mediated integration (REMI) in Komagataella phaffiiDepositorInsertSh ble
UseRandom insertional gene deletion in komagataella …PromoterTEF1 promoterAvailable SinceMarch 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG415GPD-EGFP
Plasmid#166137PurposeEGFP expression under the control of the GPD promoter yeastDepositorInsertEGFP
ExpressionYeastPromoterGDPAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG415GPD-mRuby3
Plasmid#166138PurposemRuby3 expression under control of the GPD promoter in yeastDepositorInsertmRuby3
ExpressionYeastPromoterGDPAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107
Plasmid#67639PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains LEU2 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52 and pTDH3 (aka GAP promoter)Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
EF1a_KLF16_P2A_Hygro_Barcode
Plasmid#120502PurposeBarcoded lentiviral vector to express KLF16 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only