We narrowed to 13,810 results for: OVA
-
Plasmid#114789PurposePrey vector PXC1 J2_pECIA14 should be used with bait vector PXC1 J2_pECIA2.DepositorInsertAT2G36570 (AT2G36570 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
NIK1 A11_pECIA14
Plasmid#114777PurposePrey vector NIK1 A11_pECIA14 should be used with bait vector NIK1 A11_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
RKL1 I6_pECIA14
Plasmid#114781PurposePrey vector RKL1 I6_pECIA14 should be used with bait vector RKL1 I6_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT5G16900 O2_pECIA14
Plasmid#114762PurposePrey vector AT5G16900 O2_pECIA14 should be used with bait vector AT5G16900 O2_pECIA2.DepositorInsertAT5G16900 (AT5G16900 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
SERK2 P5_pECIA14
Plasmid#114768PurposePrey vector SERK2 P5_pECIA14 should be used with bait vector SERK2 P5_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
NIK3 nA5_pECIA14
Plasmid#114769PurposePrey vector NIK3 nA5_pECIA14 should be used with bait vector NIK3 nA5_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT1G49100 L12 _pECIA14
Plasmid#114740PurposePrey vector AT1G49100 L12 _pECIA14 should be used with bait vector AT1G49100 L12 _pECIA2.DepositorInsertAT1G49100 (AT1G49100 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*leu*
Plasmid#21173DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…Available SinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCDF-casBCDE(+6)
Plasmid#89728PurposeExpresses the Cascade subunits Cse2, Cas7, Cas5, Cas6e and pre-crRNA containing a longer version of the wt spacer (+6) extended by 6 nucleotides at the leader-distal end.DepositorInsertCRISPR array
ExpressionBacterialMutationDerivative CRISPR array containing a longer versi…Available SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 extracellular-cysteineless (NT864)
Plasmid#49069PurposeExpresses human NKCC1 mutant lacking extracellular cysteine residues and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC563S,C568S,C577S,C582S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 EXOC3prom SV40
Plasmid#246713PurposeTo investigate the influence of a universal enhancer (SV40) on EXOC3 promoter activity (measured by luciferase expression)DepositorAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-Cre
Plasmid#247326PurposeExpresses Cre recombinase under the control of the Nppa Promoter.DepositorInsertNppa-Cre
UseAAVExpressionMammalianMutationTagRFP is out of frame and therefore not translat…PromoterNppa Proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-EGFP
Plasmid#247327PurposeExpresses EGFP under the control of the Nppa promoterDepositorInsertEGFP under the control of the Nppa Promoter
UseAAVExpressionMammalianPromoterNppa proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B-Q165X
Plasmid#232001PurposeBicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 MIDDLE 300BP
Plasmid#226440PurposeFor subcloning of human EXOC3 promoter (middle 300 bp) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 3' HALF
Plasmid#226439PurposeFor subcloning of human EXOC3 promoter (3' half) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 5' HALF
Plasmid#226438PurposeFor subcloning of human EXOC3 promoter (5' half) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 promEXOC3
Plasmid#205467PurposeLuciferase reporter of promoter activityDepositorAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAK-DR30(SapI)-hfCas13d-Puro-pA/EF1A-mCherry-WPRE-pA
Plasmid#233046PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d and a Puro resistance gene. It also encodes an mCherry gene. The CasRx and Puro coding regions are separated by a T2A site.DepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d and mCherry
TagsmCherryExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAK-DR30(SapI)-CasRx-Puro-pA/EF1A-mCherry-WPRE-pA
Plasmid#233045PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx and a Puro resistance gene. It also encodes an mCherry gene. The CasRx and Puro coding regions are separated by a T2A site.DepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx and mCherry
TagsmCherryExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mEtfdh
Plasmid#232314PurposeExpression of mouse mutant EtfdhDepositorInsertEtfdh (Etfdh Mouse)
UseLentiviralMutationPAM Sequence Mutations: (G36C, T39C, C42T, C72T, …Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo PTEN sgRNA5
Plasmid#233246PurposeKnock out of murine PTENDepositorInsertPTEN (Pten Mouse)
UseLentiviralAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgITGA5_5
Plasmid#233253PurposeKnock out of murine ITGA5DepositorInsertITGA5 (Itga5 Mouse)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgITGA5_4
Plasmid#233252PurposeKnock out of murine ITGA5DepositorInsertITGA5 (Itga5 Mouse)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgITGA5_1
Plasmid#233251PurposeKnock out of murine ITGA5DepositorInsertITGA5 (Itga5 Mouse)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgAGAP1_3
Plasmid#233248PurposeKnock out of murine AGAP1DepositorInsertAGAP1 (Agap1 Mouse)
UseLentiviralAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo PTEN sgRNA2
Plasmid#233245PurposeKnock out of murine PTENDepositorInsertPTEN (Pten Mouse)
UseLentiviralAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only