We narrowed to 6,946 results for: crispr cas9 plasmids

#108301

pX330 (Plasmid #42230) with the N497A, R661A, Q695A, and Q926A mutations

Yuichiro Miyaoka

Kato-Inui et al Nucleic Acids Res. 2018 May 18;46(9):467

May 18, 2018

Academic Institutions and Nonprofits only

#108295

pX459 V2.0 (Plasmid #62988) with the Y450A, N497A, R661A, Q695A, and Q926A mutations

Yuichiro Miyaoka

Kato-Inui et al Nucleic Acids Res. 2018 May 18;46(9):467

May 18, 2018

Academic Institutions and Nonprofits only

#102244

Lentiviral expression of dCas9-HA-BFP-KRAB-NLS for CRISPRi driven by a hEF1alpha promoter

Jacob Corn

Oct. 25, 2017

Academic Institutions and Nonprofits only

#160647

module containing the human codon optimized Cas9 and the BASTA selection marker

Diego Orzaez

Dec. 7, 2020

Academic Institutions and Nonprofits only

#83481

Lentiviral vector for mammalian expression of doxycycline-inducible Cas9 and constitutive expression of Blasticidin S deaminase -T2A -rtTA

Mohan Babu

Nov. 10, 2016

Academic Institutions and Nonprofits only

#174138

CMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRER(D1135V/G1218R/R1335E/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-mScarlet

Benjamin Kleinstiver

Sept. 7, 2021

Academic Institutions and Nonprofits only

#174139

CMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRQR(D1135V/G1218R/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-mScarlet

Benjamin Kleinstiver

Sept. 7, 2021

Academic Institutions and Nonprofits only

#87396

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87382

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87383

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only