We narrowed to 10,632 results for: t7
-
Plasmid#68121PurposeEncodes for Ebola Virus Zaire VP35 under control of a T7 RNA polymerase promoter.DepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pTM1_VP30_ZEBOV
Plasmid#69119PurposeEncodes for Ebola Virus Zaire VP30 under control of a T7 RNA polymerase promoterDepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3E5E_luciferase
Plasmid#69358PurposeEncodes for Ebola Minigenome with luciferase reporter gene under control of a T7 RNA polymerase promoterDepositorInsert3E5E luciferase minigenome
UseT7PromoterT7Available SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTM1_L_ZEBOV
Plasmid#69120PurposeEncodes for Ebola Virus Zaire L under control of a T7 RNA polymerase promoterDepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJin-290
Plasmid#125718PurposeABA-inducible split T7 gRNA for GFP vector using RNAPN d5-19 with CGG RNAP-CDepositorInsertPCGG-gRNA GFP-off expression, FKBP-linker-T7 RNAPC, T7 RNAPN (d5-19)-linker-FRB
ExpressionMammalianAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pr1-T7RNAP
Plasmid#67738PurposeOR2-OR1-Pr1 promoter expressing T7 RNAPDepositorInsertUTR1-T7RNAP-T500
UseSynthetic BiologyExpressionBacterialPromoterOR2-OR1-Pr1Available SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pr2-T7RNAP
Plasmid#67739PurposeOR2-OR1-P2 promoter expressing T7 RNAPDepositorInsertUTR1-T7RNAP-T500
UseSynthetic BiologyExpressionBacterialPromoterOR2-OR1-Pr2Available SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZB573_pB1H1_T7-RNAP_LARP-I5CHO_1
Plasmid#228508PurposeBacterial Hybrid Driver PlasmidDepositorInsertT7 RNAP, LARP-I5CHO (#1)
UseSynthetic BiologyTagsUmu Degron, GTG-start codonMutationR378K; S430P, N433T, S633P, F849I, F880Y; W727G, …Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZB578_pB1H1_T7-RNAP_LARP-I
Plasmid#228507PurposeBacterial Hybrid Driver PlasmidDepositorInsertT7 RNAP, LARP-I
UseSynthetic BiologyTagsUmu Degron, GTG-start codonMutationR378K; S430P, N433T, S633P, F849I, F880Y; W727G, …Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-5'TwStrep
Plasmid#208620PurposeEmpty vector for prokaryotic expression, insert a Twin Strep tag between NdeI and BamHI site of pET28a (+), both site retained, T7 tag replaced, BamHI site in-frame with Twin Strep tag.DepositorTypeEmpty backboneTagsTwin StrepExpressionBacterialPromoterT7Available SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET E. coli expression vector with BioBrick polypromoter restriction sites (14-A)
Plasmid#48307DepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET LIC cloning vector with BioBrick polycistronic restriction sites (9A)
Plasmid#48283DepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGBR22-pGEM-T
Plasmid#231055PurposeExpresses Montipora efflorescens GFP-like chromoprotein under T7 with a 6xHIS tagDepositorInsertGFP-like chromoprotein
UseCloningTags6x HISPromoterT7Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-vioABE-4A6-vioC-3A2-vioD
Plasmid#73440PurposeViolacein pathway (vioABECD) in monocistronic configuration, transcriptionally driven by orthogonal T7-lac promoter variants G6 (vioABE), 4A6 (vioC), and 3A2 (vioD) for orthogonal flux redirection.DepositorInsertPG6-vioABE-P4A6-vioC-P3A2-vioD
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPG6, P4A6, and P3A2 (orthogonal T7-lac variants)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP2283
Plasmid#70702PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2266
Plasmid#70705PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only