We narrowed to 7,325 results for: 11

#87397

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#72557

Hypoxia induced mutant PHLDA3. Contains the HRE from VEGF sequence (5 repeats) upstream of PHLDA3.

Ester Hammond

Leszczynska et al J Clin Invest. 2015 Jun;125(6):2385-98.

April 12, 2017

Academic Institutions and Nonprofits only

#48812

this report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRF

Henry Lester

Drenan et al Mol Pharmacol. 2008 Jan;73(1):27-41. Epu

April 27, 2016

Academic Institutions and Nonprofits only

#26577

Diane Lipscombe

Xu et al J Neurosci. 2001 Aug 15. 21(16):5944-51.

Jan. 31, 2011

Academic Institutions and Nonprofits only

#44508

Gabor Balazsi

Nevozhay et al Proc Natl Acad Sci U S A. 2009 Mar 31;10

April 23, 2013

Academic Institutions and Nonprofits only

#64794

Luciferase expression driven by Lin28b promoter P3

Joshua Mendell

Chang et al Proc Natl Acad Sci U S A. 2009 Mar 3;106

July 17, 2015

Academic Institutions and Nonprofits only

#110187

Expression of mouse MeCP2 (R111G) in mammalian cells

Adrian Bird

Tillotson et al Nature. 2017 Oct 19;550(7676):398-401. d

May 16, 2018

Academic Institutions and Nonprofits only

#102833

Binary vector containing Sr22 Schomburgk allele driven by maize ubiquitin promoter, Sr22 terminator

Brande Wulff

Md Hatta et al Mol Plant Microbe Interact. 2020 Nov;33(

Feb. 5, 2021

Academic Institutions and Nonprofits only

#125680

expresses human PPAT protein, with first 11 residues removed, with a C-terminal 2XStrep affinity tag

Stephen Benkovic

Liu et al J Proteome Res. 2019 May 3;18(5):2078-20

May 31, 2019

Academic Institutions and Nonprofits only

#71726

plasmid expressing fusion construct of Gal4 BDB VP16 AD and HSF1 WT RD

Lea Sistonen

Budzynski et al Mol Cell Biol. 2015 Jul;35(14):2530-40.

May 25, 2016

Academic Institutions and Nonprofits only

#13582

Dean Sheppard

Morris et al Nature. 2003 Mar 13. 422(6928):169-73.

Jan. 8, 2007

Academic Institutions and Nonprofits only

#110189

Expression of mouse MeCP2 (deltaN) in mammalian cells

Adrian Bird

Tillotson et al Nature. 2017 Oct 19;550(7676):398-401. d

May 16, 2018

Academic Institutions and Nonprofits only

#183636

PET28-FnCas12a-EP16 can efficiently recognize a broad range of PAM sequences including YN (Y = C or T), TAC and CAA.

Yunzi Luo

Wang et al Biotechnol Bioeng. 2019 Jun;116(6):1463-

Oct. 26, 2022

Academic Institutions and Nonprofits only

#44514

Gabor Balazsi

Nevozhay et al Proc Natl Acad Sci U S A. 2009 Mar 31;10

April 23, 2013

Academic Institutions and Nonprofits only