We narrowed to 4,229 results for: PRS
-
Plasmid#162605PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTEF-Sup35C
Plasmid#1202DepositorInsertSup35 C-terminus (SUP35 Budding Yeast)
ExpressionYeastMutationSup35 C-terminus ~254aa-endPromoterTEFAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only -
pAG416GPD-Cerulean-YPT7
Plasmid#18847DepositorAvailable SinceNov. 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAG416GPD-Cerulean-YPT31
Plasmid#18849DepositorAvailable SinceNov. 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCas9
Plasmid#162606PurposePre-express Cas9 in yeastDepositorInsertTef1-Cas9
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
bRA90
Plasmid#100951PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. LEU2 markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUNIV-EGFP
Plasmid#24706DepositorInsertEGFP (eGFP Aequoria victoria)
ExpressionBacterial, Mammalian, and Y…Available SinceDec. 6, 2010AvailabilityAcademic Institutions and Nonprofits only -
csr-1_son-1_mNeonGreen
Plasmid#191743PurposeTest fluorescent properties in Neurospora crassa. Nuclear envelope fluorescent reporter.DepositorInsertNCU04288 (NCU04288 Neurospora crassa)
TagsNCU04502 promoter and mNeonGreenExpressionBacterialAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-X0
Plasmid#115565PurposeControl vector expressing GFP alone without any consensus repeatsDepositorInsertGreen Fluorescent Protein
ExpressionBacterial and YeastPromoterADH1Available SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only