We narrowed to 4,229 results for: PRS
-
Plasmid#62315PurposesgRNA with 2x MS2 (wt+f6) for yeast cellsDepositorInsertsgRNA + 2x MS2 (wt+f6) binding module
ExpressionYeastPromoterSNR52Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
KBB460
Plasmid#185094PurposeNMA111-GFP wild type under endogenous promoterDepositorInsertNMA111
TagsGFPExpressionYeastMutationNMA111-GFPAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
RSV-betaGal
Plasmid#24058DepositorAvailable SinceOct. 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP8m
Plasmid#18717DepositorAvailable SinceJune 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
Gal1/10p CAS9 Gal1/10p I-SceI
Plasmid#182519PurposeGalactose-Induced Expression vector for Cas9 and I-SceI.DepositorInsertsI-SceI
Cas9
ExpressionYeastAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJZC603
Plasmid#62317PurposesgRNA with 2x PP7 for yeast cellsDepositorInsertsgRNA + 2x PP7 RNA binding module
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTCW012
Plasmid#83527PurposeCloning destination vector for phermone mediated expression from the FUS1J2 promoter and CYC1 terminatorDepositorTypeEmpty backboneExpressionYeastPromoterpFUS1J2Available SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pABY-c46
Plasmid#201774PurposeExpresses mNeonGreen-tagged NbALFA under TEF1 promoter in yeastDepositorInsertNbALFA
Tags40aa Linker, mNeonGreenExpressionYeastPromoterTEF1Available SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
PHBA02
Plasmid#83536PurposeConstitutive TEF1 promoter mediated expression of the UBiC and ARO4* genesDepositorInsertpTEF1-ARO4*-CYC1t-pTEF1-UBiC-CYC1t
ExpressionYeastPromoterpTEF1Available SinceDec. 16, 2016AvailabilityAcademic Institutions and Nonprofits only