We narrowed to 7,773 results for: aav
-
Plasmid#230050PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of EGFP through the OPTi-OX platformDepositorInsertTRE3VG_EGFP
ExpressionMammalianPromoterGAAGACAATAGCAGGCATGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgAAVS1_145
Plasmid#213166PurposeVector with sgAAVS1 for induction of global DNA methylation.DepositorInsertsgAAVS1_145
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgAAVS1_118
Plasmid#213167PurposeVector with sgAAVS1 for induction of global DNA methylation.DepositorInsertsgAAVS1_118
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNM220_AAVS1 integration helper
Plasmid#211864PurposeCas9 cutting at AAVS1 safe harbor locusDepositorInsertAAVS1
UseCRISPRMutationN/AAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 SNAP-Sec61B
Plasmid#207580PurposeHomologous recombination donor to integrate and expression cassette for SNAPtag-Sec61B in the AAVS1 locus of human cellsDepositorInsertTET inducible SNAPTag-Sec61B
TagsSNAPTAGExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NODALvar
Plasmid#115640PurposeFor targeted integration and inducible expression of a human NODAL splice variant using doxycyclineDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
2ERT2-AAVS1 TALEN-L
Plasmid#120544PurposeDrug inducible TALEN targeting the human AAVS1 locus for genome editingDepositorInsertERT2, hAAVS1 1L TALEN
UseLentiviralExpressionMammalianPromoterEF1αAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS2113
Plasmid#49138PurposeAAV plasmid with FEV (Ple67) promoter driving expression of EmGFP. Contains WPRE.DepositorInsertssAAV-Ple67-emGFP-WPRE
UseAAVExpressionMammalianPromoterFEVAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pZac2.1 EFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2
Plasmid#78607PurposeA single vector AAV-Cas9 system containing SaCas9 under EFs promoter, gRNAs targeting Dmd introns 22 and 23DepositorInsertEFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterEF1a-short; U6Available SinceSept. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
AV0-hSyn-SV40pA
Plasmid#124965PurposeExpress gene of interest under human Syn promoterDepositorTypeEmpty backboneUseAAVAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
psubCMV-mVEGF-D-WPRE
Plasmid#119226PurposePlasmid encodes full-length (unprocessed) murine VEGF-D to be used for stimulation of lymphangiogenesis in mice in vivo.DepositorAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-166:CDH1-mEGFP
Plasmid#193921PurposeHomology arms and LE-mEGFP sequence for C-terminus tagging of human cadherin 1DepositorInsertcadherin 1 Homology Arms with LE-mEGFP (CDH1 Human)
UseAAV and CRISPR; Donor templateTagslinker-mEGFPMutationhomology arms contain point mutations to disrupt …Available SinceDec. 22, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDF0584 huDisCas7-11 S1006-GGGS-D1221 U6-NT guide
Plasmid#186993PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of non-targeting crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, non-targeting crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEMS2031
Plasmid#49134PurposeAAV plasmid with OLIG1 (Ple305) promoter driving expression of iCre.DepositorInsertssAAV-Ple305-iCre
UseAAVExpressionMammalianPromoterOLIG1Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pNTI826
Plasmid#216634PurposecpTurboID (V5) for AAV productionDepositorInsertcpTurboID
UseAAVTagsV5ExpressionMammalianAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS2118
Plasmid#49143PurposeAAV plasmid with smCBA promoter driving expression of iCre. Contains WPRE.DepositorInsertssAAV-smCBA-iCre-WPRE
UseAAVExpressionMammalianPromotersmCBAAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
v3em-Cterm-PEmaxdeltaRNaseH-dualU6-Dnmt1-PE3-loxP
Plasmid#207862PurposeAAV genome encoding C-terminal PEmaxDRNaseH and U6 expression cassettes for Dnmt1 PE3 pegRNA and ngRNADepositorInsertNpuC-Cterm-PEmaxDRNaseH-dualU6-Dnmt1-PE3-loxP
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only