We narrowed to 9,891 results for: tre promoter
-
Plasmid#187458PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 epegRNA (tevopreQ1) with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N epegRNA (tevopreQ1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Ser62Ala_P2A_Hygro_Barcode
Plasmid#120514PurposeBarcoded lentiviral vector to express MYC Ser62Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Ser62Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Serine to Alanine at amin…PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowG-AURKA-mTurq2
Plasmid#157768PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL(EF1a-phi-AQP1-FKBP12DD-IRES-EGFP-WPRE)
Plasmid#236279PurposeLentiviral vector that can express hAqp1 with fkbp12 degron in mammalian cells. EF1a promoter. EGFP marker.DepositorInserthuman aquaporin 1 (AQP1 Human)
UseLentiviralTagsFlag and fkbp12ExpressionMammalianPromoterEF1aAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL(CMVtight-phi-AQP1-FKBP12DD-IRES-EGFP-WPRE)
Plasmid#236278PurposeLentiviral vector that can express doxycycline-inducible hAqp1 with fkbp12 degron in Tet ON mammalian cells. CMVtight promoter. EGFP marker.DepositorInserthuman aquaporin 1 (AQP1 Human)
UseLentiviralTagsFlag and fkbp12ExpressionMammalianPromoterCMVtightAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-hSNCA (A11P/V70P)
Plasmid#185717PurposeAAV expression of GFP and human α-Synuclein with A11P and V70P mutations from hSyn promoterDepositorInsertsynuclein, alpha (SNCA Human)
UseAAVMutationChanged Ala 11 to Pro, Val 70 to ProPromoterhSynAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowY-AURKA-mTurq2
Plasmid#157770PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPN432
Plasmid#137870PurposeExpression of gRNA a3 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN431
Plasmid#137869PurposeExpression of gRNA a2 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN435
Plasmid#137867PurposeExpression of gRNA i3 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN434
Plasmid#137866PurposeExpression of gRNA i2 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN446
Plasmid#137868PurposeExpression of gRNA a1 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN454
Plasmid#137865PurposeExpression of gRNA i1 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Glu39Ala_P2A_Hygro_Barcode
Plasmid#120512PurposeBarcoded lentiviral vector to express MYC Glu39Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Glu39Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Glutamic Acid to Alanine …PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST p38KTRmCerulean3
Plasmid#59155PurposeLentiviral vector to express p38 KTR mCerulean3 under CMV promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Human, Mouse)
UseLentiviralTagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-Kir2.1-P2A-EGFP
Plasmid#176278PurposeViral vector for co-expression of Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1-P2A-EGFP (Kcnj2 Mouse, Synthetic)
UseAAV and Cre/LoxTagsMycExpressionMammalianPromoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Pos
Plasmid#61857PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, positive strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Neg
Plasmid#61856PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, negative strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -