We narrowed to 12,216 results for: SHA;
-
Plasmid#125006PurposeExpresses gRNAs targeting hedgehog and winglessDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only
-
OA-1045E
Plasmid#125007PurposeExpresses tRNA-flanked gRNAs targeting hid, eve, and hedgehogDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1045A
Plasmid#125003PurposeExpresses gRNAs targeting hid and eveDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
iSKetSnFR2
Plasmid#140467PurposeDevelop a family of genetically encoded fluorescent biosensors for S-ketamine, termed iSKetSnFR2, thus enabling optical subcellular pharmacokinetics for S-Ketamine.DepositorInsertiSKetSnFR2
TagsHis Tag, HA Tag and Myc tagExpressionBacterialPromoterT7Available SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
iSKetSnFR1
Plasmid#140466PurposeDevelop a family of genetically encoded fluorescent biosensors for S-ketamine, termed iSKetSnFR1, thus enabling optical subcellular pharmacokinetics for S-Ketamine.DepositorInsertiSKetSnFR1
TagsHis Tag, HA Tag and Myc tagExpressionBacterialPromoterT7Available SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mutNSDHL
Plasmid#136428PurposeExpresses NSDHL harboring all currently known mutations within exons 4 and 6 associated with CHILD syndrome.DepositorInserthuman NSDHL with mutations in exon 4 and exon 6 (NSDHL Human, Synthetic)
TagsV5-His tagExpressionMammalianMutationC>T = A105V; G>C = A182P; G>A = R199H; G…PromoterCMVAvailable SinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-147
Plasmid#136020PurposeEIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-464
Plasmid#136021PurposeEIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552
Plasmid#136022PurposeEIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-464
Plasmid#136023PurposeEIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-552
Plasmid#136024PurposeEIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Unstructured
Plasmid#136026PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-Unstructured-EIF3B
Plasmid#136027PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
A3H HapII R175/6E-Cas9n-UGI
Plasmid#119142PurposeBase editor made from APOBEC3H Haplotype II RNA binding mutant RR175/6EEDepositorInsertAPOBEC3H Haplotype II RR175/6EE-Cas9 nickase-UGI
UseCRISPRMutationA3H Hap II RR175/6EEPromoterCMVAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Nkx3-2_Anti-Sense
Plasmid#124438PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pProEx-Htb-cytATL2(R323Q)-6Gly-sfGFP
Plasmid#124066PurposeE. coli. exp. and purif. of X. laevis cytATL-R232Q fragment fused to GFP in c-terminus.DepositorInsertcytATL-R232Q-sfGFP
TagssfGFPExpressionBacterialMutationR232QPromotertrcAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Nkx3-2_Sense
Plasmid#124437PurposePlasmid for sense in situ probe in vitro transcriptionDepositorAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Rab28_Sense
Plasmid#124441PurposePlasmid for sense in situ probe in vitro transcriptionDepositorAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Rab28_Anti-Sense
Plasmid#124442PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only