We narrowed to 10,491 results for: fus
-
Plasmid#126081PurposevCre-Dependent ChR2(H134R)-eYFP with the vLox sites in the reverse orientationDepositorInserthChR2(H134R)-eYFP
UseAAVTagseYFPMutationH134RPromoterEf1aAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-N-Strep2
Plasmid#119758PurposeAllows cloning of gene of interest into bacterial expression vector with PreScission Protease cleavable N-terminal GST tag, and a retained N-terminal Strep-II tag.DepositorTypeEmpty backboneTagsGST and Strep-tag II fusion tagExpressionBacterialPromotertac promoterAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC-attB-burs-mCD8-EGFP-T2A-Gal4
Plasmid#39463DepositorInsertburs-mCD8-EGFP-T2A-Gal4
PromoterbursalphaAvailable SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET Biotin His6 FlAsH LIC cloning vector (H6-FlAsH)
Plasmid#30184DepositorTypeEmpty backboneTags6xHis, AviTag (biotin), FlAsH, and TEV cleavage s…ExpressionBacterialAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Connexin43-APEX
Plasmid#44439DepositorInsertConnexin43 fused to pea APEX
TagsmycExpressionMammalianMutationK14D, W41F, E112K mutations on APEXPromoterCMVAvailable SinceMay 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
FsC_pET29b
Plasmid#215405PurposeExpression construct for FsC gene, codon optimized for expression in E. coliDepositorInsertFsC
ExpressionBacterialAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_P0826-BB0323-mCherryBb
Plasmid#118244PurposeKanamycin-resistant E.coli/B. burgdorferi shuttle vector; Encodes a BB0323-mCherry translational fusion under the control of the bb0826 promoterDepositorInsertBB0323-mCherry translational fusion under the control of the bb0826 promoter
TagsmCherryExpressionBacterialAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET mRuby2 LIC cloning vector (H6-mRuby2)
Plasmid#86934PurposepET LIC cloning vector for Biotin-His6-tev-yORF-mRuby2DepositorTypeEmpty backboneTags6xHis, AviTag (biotin), TEV cleavage site, and mR…ExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceMarch 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
JA740
Plasmid#49939PurposeExpresses a TALE-TET1FL (full length TET1) fusion protein engineered to bind a site in EGFP for use as a controlDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFX-EGFP-Rab5
Plasmid#174454PurposeExpress EGFP with early endosome-targeting sequence in mammalian cellsDepositorInsertEGFP with early endosome-targeting sequence
Tagssmall GTPase (Rab5)ExpressionMammalianPromoterCMVAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFX-mCherry-Rab11
Plasmid#174461PurposeExpress mCherry with recycling endosome-targeting sequence in mammalian cellsDepositorInsertmCherry with recycling endosome-targeting sequence
Tagssmall GTPase (Rab11)ExpressionMammalianPromoterCMVAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
N-BLa 1.2
Plasmid#88999PurposeBLaTM, a genetic tool to measure homo- and heterotypic transmembrane helix-helix interactions. Plasmid encoding the 1.2 fusionprotein containing the N-terminal fragment of the split β-lactamase.DepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialPromoteraraBADAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-TP3
Plasmid#160086PurposeBacterial expression of Tn5-APEX2 fusion protein with linker AEAAAKEAAAKADepositorInsertTn5 transposase/APEX2 peroxidase fusion protein
TagsFLAG and Mxe intein - Chitin-binding domainExpressionBacterialAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
C-BLa 1.2
Plasmid#89000PurposeBLaTM, a genetic tool to measure homo- and heterotypic transmembrane helix-helix interactions. Plasmid encoding the 1.2 fusionprotein containing the C-terminal fragment of the split β-lactamase.DepositorInsertC-BLa 1.2 fusion protein
TagsFlagExpressionBacterialPromoteraraBADAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cenp-B INCENP GFP
Plasmid#45238PurposeTarget INCENP to centromeres via full length CENP-BDepositorInsertCenp-B, INCENP-Δcen, GFP
TagsGFP and full length CENP-BExpressionMammalianMutationCEN box deleted from INCENP (aa1-46)Available SinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBFC1207
Plasmid#186694PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, GmR+sfGFP cargo, with ET-Seq (AsiSI+SbfI) restriction sites flanking Tn7 Right EndDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
Vc_2xBsaI_NT (Guide Stuffer) crRNA
Tn7 transposon
GmR+sfGFP VcDART Cargo
SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFX-mito-mKate2
Plasmid#174178PurposeExpress mKate2 with mitochondria-targeting sequence in mammalian cellsDepositorInsertmKate2 with mitochondria-targeting sequence
Tagsthe mitochondria-targeting sequence of the cytoch…ExpressionMammalianPromoterCMVAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA4
Plasmid#101417PurposeDonor Vector containing GATA4 transcription factor, part of the Human TFome CollectionDepositorInsertGATA4 (GATA4 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -