-
Plasmid#53284PurposeContains crtE, crtB, and idi genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and pds (crtP) gene of Synechococcus PCC7942, and thereby produces zeta-carotene in E. coliDepositorInsertpds
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterlacAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-ZETA
Plasmid#53316PurposeContains Erwinia herbicola Eho10 genes crtE and crtB, together with the pds (crtP) gene of Synechococcus PCC7942 fused to the lacZ gene at the N terminus. Produces zeta-carotene in E. coli.DepositorInsertpds
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterlazZAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-NEUR
Plasmid#53271PurposeContains the Erwinia herbicola (Pantoea agglomerans) Eho10 genes crtE and crtB, and the Rhodobacter capsulatus crtI gene and thereby produces neurosporene in Escherichia coliDepositorInsertcrtI
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterendogenous promotersAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-PHYT
Plasmid#53300PurposeContains Erwinia herbicola Eho10 (Pantoea agglomerans) crtE and crtB genes, and thereby produces phytoene in E. coliDepositorInsertcrtE, crtB
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterendogenous promotersAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
XE28 XBC 40
Plasmid#16842DepositorInsertbeta-catenin-myc (ctnnb1.L Frog)
UseXenopus expressionTags6x mycExpressionMutationPromoterAvailable sinceMay 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAL942
Plasmid#119721Purposeprecursor slow-folding rbsB with the mutations Alanine 248 Threonine, Alanine 188 Cysteine and Glutamic acid 246 CysteineDepositorInsertprecusor slow-folding ribose import binding protein, rbsB, mutations A248T, A118C and E246C
UseTagsnoneExpressionBacterialMutationAlanine 248 to Threonine, Alanine 188 to Cysteine…PromoterT7Available sinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pkk223_EcMutY
Plasmid#213110Purposepkk223 with E coli MutY insertDepositorInsertMutY (adenine glycosylase) (mutY Escherichia coli)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
NmMetNI-WT
Plasmid#172114PurposeExpression of MetN and MetI membrane proteinsDepositorInsertsMetN
MetI
UseTags10x His Tag and EnterokinaseExpressionBacterialMutationPromoterT7 PromoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAC-LYC
Plasmid#53270PurposeContains 3 genes (crtE, crtI, and crtB) of the carotenoid pathway gene cluster of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces lycopene in Escherichia coliDepositorInsertcrtE, crtI, crtB
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterendogenous promotersAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-CANTHipi
Plasmid#53301PurposeContains crtE, idi, crtI, crtY, and crtB genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and a crtO cDNA of Haematococcus pluvialis fused to a Trc promoter. Produces canthaxanthin in E. coli.DepositorInsertcrtO
UseLow copy number bacterial cloning vectorTags6HisExpressionMutationPromoterTrcAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-ZEAXipi
Plasmid#53287PurposeContains crtE, idi, crtI, crtY, crtB, and crtZ genes of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces zeaxanthin in E. coliDepositorInsertcrtE, idi, crtY, crtI, crtB, crtZ
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterendogenous promotersAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-NLRC5
Plasmid#37521DepositorInsertNLRC5 (NLRC5 Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
ChromosomesMembranesandCytoskeleton
Plasmid#62450PurposeMXS_chaining vector with 4 cassettesDepositorInsertsCMV::H2B-TagBFPx3-bGHpA
CMV::Lyn-Ceruleanx3-bGHpA
CMV::mCherryx3-linker-betaActin-bGHpA
CMV::Citrinex3-linker-alphaTubulin-bGHpA
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-BETA-At
Plasmid#53288PurposeContains crtE, crtB, and crtI genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and an lcyB cDNA of Arabidopsis thaliana. Use with pY2F to produce alpha-carotene in E. coli.DepositorInsertlcyB (LYC Mustard Weed)
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoternoneAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-aZEA
Plasmid#53286PurposeContains crtE, and crtB genes of Erwinia herbicola (Pantoea agglomerans) Eho10, crtI gene of Rhodobacter capsulatus, and lcyE cDNA of Arabidopsis thaliana and produces alpha-zeacarotene in E. coliDepositorInsertlcyE (LUT2 Mustard Weed)
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterlacAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAPi
Plasmid#127548PurposeEmpty control for pGAPi-based RNAi silencing in tandem with APT transcript segmentDepositorInsertAdenine Phosphorybosyltransferase transcript segment
UseRNAi; Empty controlTagsExpressionMutationPromoterUbiquitinAvailable sinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAC-BETA
Plasmid#53272PurposeContains crtE, crtB, crtI, and crtY carotenoid pathway genes of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces beta-carotene in Escherichia coliDepositorInsertcrtE, crtY, crtI, crtB
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterendogenous promotersAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
HF-PX459 (V2)
Plasmid#118632PurposePlasmid encoding SpCas9-HF1, a single guide RNA and puromycin resistanceDepositorInserthSpCas9-HF1-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationAsparagine 497 to Alanine, Arginine 661 to Alanin…PromoterCbhAvailable sinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRN3P_T3_ABE8e_IVT
Plasmid#201676PurposePlasmid to be used as DNA template for in vitro RNA transcription of the ABE8e base editor (A to G) by T3 RNA polymerase. The plasmid contains optimised 5'UTR and 3'UTR to improve protein expression.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPR; Vector for in-vitro transcriptionTagsExpressionMutationPromoterT3 promoterAvailable sinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only