We narrowed to 60,877 results for: Ran
-
Plasmid#62186PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and renilla luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertRenilla luciferase
UseLuciferase; Mule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
p3015b
Plasmid#209317PurposeExpresses a sgRNA template with a protospacer cloning site flanked by BsaI restriction sites for easy insertion of a targeting cassette.DepositorInsertGroup B Streptococcus-compatible single guide RNA
ExpressionBacterialPromoterXyl/tet promoter that is constitutively activeAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
cjBlue chromoprotein
Plasmid#117844PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses cjBlue chromoprotein in E. coliDepositorInsertpromoter, RBS, cjBlue
UseSynthetic Biology; Escherichia coliMutationBioBrick sites removedAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHis6-hDF
Plasmid#72585Purposehuman dysferlin full length tagged with HisDepositorAvailable SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
vDip-C: pAAV-Pcp2-mGreenLantern-KASH
Plasmid#207613PurposevDip-C AAV vector with mouse Pcp2 (also known as L7) promoter driving green fluorophore mGreenLantern with a KASH nuclear membrane tag to isolate cell nuclei of cerebellar Purkinje cellsDepositorInsertmGreenLantern
UseAAVTagsKASHPromotermouse Pcp2 promoter (L7-6)Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMuLE Lenti Dest Neo
Plasmid#62178PurposeMuLE (Multiple Lentiviral Expression) Destination vector for use with pMuLE Entry vectors. Co-expresses Neomycin cassette under the control of a PGK promoter. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseLentiviral; Mule gateway destination vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
mRuby2-Tubulin-C-18
Plasmid#55915PurposeLocalization: Microtubules, Excitation: 559, Emission: 600DepositorAvailable SinceMarch 10, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
BtuF
Plasmid#92209PurposeExpression of BtuF which is the vitamin B12 binding protein for BtuCD ABC TransporterDepositorInsertBtuF (btuF )
Tags6x His Tag and PelB Signal SequenceExpressionBacterialMutationBtuF signal sequence removed and uses the PelB si…PromoterT7 PromoterAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-mTagBFP2-2A-Puro_hU6-RfxDR36-BsmBI
Plasmid#226011PurposeCasRx guide RNA cloning backbone (lenti)DepositorTypeEmpty backboneUseLentiviralAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
FKBP-CD28TMD-NTEVp(H75E)
Plasmid#137829PurposeMESA split-TEV protease chain with FKBP Rapamycin ectodomain, CD28 transmembrane domain, N-terminal H75E mutant TEV proteaseDepositorInsertFKBP-CD28TMD-NTEVp(H75E)
Tags3x FLAGExpressionMammalianMutationMutated Histidine 75 to Glutamic Acid in NTEVp fr…PromoterCMVAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SLC5A7
Plasmid#218539Purposehuman SLC5A7 cDNADepositorAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SLC44A1
Plasmid#218538Purposehuman SLC44A1 cDNADepositorAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-cGAS-N-HA
Plasmid#130913PurposeExpresses human cGAS N terminus(aa1-159)-HA; Puromycin selection markerDepositorInsertcGAS N terminus
TagsHAExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 Ruby3-Rab6A
Plasmid#135653PurposeRab6A fused to the red fluorescent protein Ruby3 in N-ter under control of a weak L30 promoter.DepositorInsertRab6A
TagsRuby3ExpressionMammalianPromoterL30Available SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-SaCas9-pU6-sgRNA
Plasmid#159173PurposeVector A encodes pAAV-pMecp2-SaCas9-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of SaCas9-sgRNA in neuronsDepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
GST-Delta23C11orf83
Plasmid#65849Purposebacterial expression of GST (N-ter) - Delta 23 C11orf83/UQCC3 (UQCC3 protein depleted of its N-terminal transmembrane domain)DepositorInsertUQCC3 depleted of its N terminal transmembrane part (UQCC3 Human)
TagsGSTExpressionBacterialMutationdeletion of the 23 first aa (TM)Available SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
meffRed chromoprotein
Plasmid#117836PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses meffRed chromoprotein in E. coliDepositorInsertpromoter, RBS, meffRed
UseSynthetic Biology; Escherichia coliMutationBioBrick sites removedAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCLJ-F2P-LoxP-PGK-NeoR-LoxP
Plasmid#227503PurposeInserts 500bp Prdm8 promoter in place of the Fgf5 promoter along with removable selection cassetteDepositorInsertPrdm8 promoter
UseAAV and Cre/LoxAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBabe WT Akt2
Plasmid#14551DepositorAvailable SinceApril 12, 2007AvailabilityAcademic Institutions and Nonprofits only