We narrowed to 76,952 results for: Rest
-
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(535/81, eGFP)
Plasmid#221612PurposeAAV encoding PiGM-Iq with minimal RGS10 domain, CRY2 (535 amino acid version), CIB1 (81 amino acid version).DepositorInsertPiGM-Iq (535/81,eGFP)
UseAAVMutationRGS2 1-53 truncationPromoterHuman SynapsinAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_THADA_alltoneg0
Plasmid#232372PurposeTHADA enhancer, all sensitizing elements made into buffering CoordinatorDepositorInsertTHADA (THADA Human)
UseLuciferaseMutationTHADA enhancer, all sensitizing elements made int…Available SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPMS-2016
Plasmid#232290PurposeProtein ExpressionDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-tagBFP
Plasmid#219965Purposeexpress TagBFP in mammalian cellsDepositorInsertTagBFP
UseRetroviralExpressionMammalianAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-35aaNSP1noMSA11-NSP5(io)
Plasmid#220827PurposeExpress the short Rotavirus SA11 NSP1 protein (35 amino acids) that lacks all methionines fused with the full-length recoded NSP5 proteinDepositorInsertRotavirus SA11 35aaNSP1noM-NSP5(io)
UseOtherMutationthe 35aa NSP1 lacks all MethioninesAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-35aaNSP1SA11-P2A-NSP5(io)-GS-smURFP
Plasmid#220828PurposeExpress separately the short Rotavirus SA11 NSP1 protein (35 amino acids) and the full-length recoded NSP5 protein fused with GS-linker and smURFPDepositorInsertRotavirus SA11 35aaNSP1-P2A-NSP5(io)-GS-smURFP
UseOtherAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-35aaNSP1noMSA11-NSP5(wt)
Plasmid#220826PurposeExpress the short Rotavirus SA11 NSP1 protein (35 amino acids) that lacks all methionines fused with the full-length SA11 NSP5 proteinDepositorInsertRotavirus SA11 35aaNSP1noM-NSP5(wt)
UseOtherMutationthe 35aa NSP1 lacks all MethioninesAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-35aaNSP1SA11-Green Lantern(wt)
Plasmid#220821PurposeExpress the hybrid protein combining 35 amino acids from Rotavirus SA11 NSP1 protein with the Green Lantern wt protein carrying an ER-localization signal at the N- and C-terminiDepositorInsertRotavirus SA11 35aaNSP1-Green Latern(wt)
UseOtherAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-35aaNSP1SA11-Green Lantern(io)
Plasmid#220822PurposeExpress the hybrid protein combining 35 amino acids from Rotavirus SA11 NSP1 protein with the recoded Green Lantern protein carrying an ER-localization signal at the N- and C-terminiDepositorInsertRotavirus SA11 35aaNSP1-Green Latern(io)
UseOtherAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac HTB His-TEV-rDPP9(S729A)-FLAG
Plasmid#217329PurposePurification of catalytically-dead rat DPP9 fusion with C-terminal FLAG tagfrom insect cellsDepositorInsertDPP9
TagsFLAG and His-TEVExpressionInsectMutationS729APromoterpolyhedrinAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-GFAPp-PiGM-Iq(eGFP)
Plasmid#221606PurposeA recombinant AAV2 plasmid encoding the PiGM-Iq system with CRY2PHR, CIBN and EGFP as expression marker. GFAP promoter for astrocyte-selective expression.DepositorInsertPiGM-Iq (eGFP)
UseAAVMutationRGS2 1-53 truncationPromoterGFAP promoterAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXR004_puroR
Plasmid#219820PurposehU6-driven pre-gRNA plasmid for CasRx applications with puromycin resistance. 5' processed DR followed by BbsI sites for guide cloning (Adapted from plasmid #10954)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterhU6Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Hipk1
Plasmid#221508PurposeRetrovirus-mediated gene transfer into mammalian cells to overexpress Hipk1DepositorAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBH001
Plasmid#215761PurposeNBU2 backbone with BsmBI restriction sitesDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBH002
Plasmid#215771PurposeNBU1 backbone with BsmBI restriction sitesDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1-Pur-BFP-P2A-ppViperin
Plasmid#217483PurposeExpression of Blue Fluorescent Protein - P2A - short length protein kinase R from chinook salmonDepositorInsertBFP-P2A-otPKRSL
ExpressionMammalianPromoterCMVAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-mEGFP-P2A-otch25hb4
Plasmid#217484PurposeExpression of Green Fluorescent Protein - P2A - full length cholesterol 25-hydroxylase-like protein from chinook salmonDepositorInsertmEGFP-P2A-otch25hb4
ExpressionMammalianPromoterCMVAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Zeo-BFP-P2A-ppViperin
Plasmid#217482PurposeExpression of Blue Fluorescent Protein - P2A - medium length protein kinase R from chinook salmonDepositorInsertBFP-P2A-otPKRML
ExpressionMammalianPromoterCMVAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-BFP-P2A-otPKR-ML
Plasmid#214361PurposeExpression of the Blue Fluorescent Protein - P2A - medium length protein kinase R from chinook salmonDepositorInsertBFP-P2A-otPKRML
ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-BFP-P2A-otPKR-SL
Plasmid#214362PurposeExpression of the Blue Fluorescent Protein - P2A - short length protein kinase R from chinook salmonDepositorInsertBFP-P2A-otPKRSL
ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-BFP-P2A-otPKR-FL
Plasmid#214360PurposeExpression of the Blue Fluorescent Protein - P2A - full length protein kinase R from chinook salmonDepositorInsertBFP-P2A-otPKRFL
ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmVen-C16orf59
Plasmid#211423Purposemammalian expression of human C16orf59 N-terminally fused to mVenusDepositorAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCer-C16orf59
Plasmid#211422Purposemammalian expression of human C16orf59 N-terminally fused to mCeruleanDepositorAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-C16orf59-mCer
Plasmid#211424Purposemammalian expression of human C16orf59 C-terminally fused to mCeruleanDepositorAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_EVA71_VP12A
Plasmid#212977PurposeEncodes EV-A71 4643 VP12A optimized for expression in mammalian transcription/translation extractsDepositorInsertEnterovirus A71 4643 VP12A
UseMammalian cell free protein expressionTagsHA tagPromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_EVD68_VP12A
Plasmid#212984PurposeEncodes EV-D68 MO/14/18947 VP12A optimized for expression in mammalian transcription/translation extractsDepositorInsertEV-D68 MO/14/18947 VP12A
UseMammalian cell free protein expressionTagsHAPromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_EVD68_3ABC
Plasmid#212979Purposencodes EV-D68 MO/14/18947 3ABC optimized for expression in mammalian transcription/translation extractsDepositorInsertEV-D68 MO/14/18947 3ABC
UseMammalian cell free protein expressionTagsHAPromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only