We narrowed to 7,193 results for: gan
-
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual
Plasmid#207883PurposeExpresses thermosensitive variants of the homing endonucleases I-OnuI and I-GpeMI, each in a different open reading frame. Both were made thermosensitive by a fusion with the L212P VMA1 intein.DepositorInsertsThermosensitive fusion of I-OnuI and the L212P VMA1 intein.
Thermosensitive fusion of I-GpeMI and the L212P VMA1 intein.
UseSynthetic BiologyExpressionBacterialMutationLeucine 212 changed to proline, leucine 434 in th…Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_THAS1
Plasmid#103859PurposeHeterologous, cobalt-inducible expression of SQE1 and THAS1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertthalianol synthase 1 (THAS1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
ptGSVG
Plasmid#248056PurposePlant organelle-genome-specific random C-to-T mutagenesisDepositorInsertArabidopsis thaliana RPS5A promoter
ExpressionPlantMutation4 amino acid changes (S1326G, G1348S, A1398V, S14…Available SinceJune 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
mtGSVG
Plasmid#248058PurposePlant organelle-genome-specific random C-to-T mutagenesisDepositorInsertArabidopsis thaliana RPS5A promoter
ExpressionPlantMutation4 amino acid changes (S1326G, G1348S, A1398V, S14…Available SinceJune 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
cAMP-dependent protein kinase (PKA) regulatory 1a subunit (R1a)
Plasmid#215436PurposeBacterially expressed R1a (no HiBiT) Ni-NTA purificationDepositorInsertHuman cAMP-dependent protein kinase type I-alpha subunit (PRKAR1A) mRNA, complete cds, C-terminal 10X-His.Thrombin Tag
Tags10X His-tag with thrombin siteExpressionBacterialMutationCodon Optimized for bacterial expression, T7 gene…PromoterT7 PromotorAvailable SinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
mtSepCD_GSVG
Plasmid#248059PurposePlant organelle-genome-specific random C-to-T mutagenesisDepositorInsertArabidopsis thaliana RPS5A promoter
ExpressionPlantMutation4 amino acid changes (S1326G, G1348S, A1398V, S14…Available SinceJune 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pT22iuasvApoWChe(#488)
Plasmid#184108Purposecyclofen-inducible apoptosis activation and imaging (mCherry) in zebrafish permanent transgenicDepositorInsertmyr-DIAP1-nls'-mCherry-P2A-Casp9-ERT2
UseZebrafish transgenesis (blue eyes)MutationDIAP1: deleted 1-2, N19G, N20V, deleted 146-438; …Promoter4xUASAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2iApowriter2(#336)
Plasmid#184104Purposecyclofen-inducible apoptosis activation and imaging (tEosFP) in zebrafish transient transgenicDepositorInsertmyr-DIAP1-5myc-tEosFP-nls'-P2A-Casp9-ERT2
UseZebrafish transient transgenesisTagsinternal tag: 5mycMutationDIAP1: deleted 1-2, N19G, N20V, deleted 146-438; …PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2iU6Apowriter2N(#355)
Plasmid#184106Purposecyclofen-inducible apoptosis activation and imaging (tEosFP) by zebrafish transient transgenesis or mRNA synthesisDepositorInsertmyr-DIAP1-5myc-tEosFP-nls'-P2A-Casp9-ERT2
UseZebrafish transient transgenesis + in vitro trans…Tagsinternal tag: 5mycMutationDIAP1: deleted 1-2, N19G, N20V, deleted 146-438; …PromoterZf-Ubi+SP6Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22Apowriter2(#340)
Plasmid#184105Purposecyclofen-inducible apoptosis activation and imaging (tEosFP) in zebrafish permanent transgenicDepositorInsertmyr-DIAP1-5myc-tEosFP-nls'-P2A-Casp9-ERT2
UseZebrafish transgenesis (blue eyes)Tagsinternal tag: 5mycMutationDIAP1: deleted 1-2, N19G, N20V, deleted 146-438; …PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22iuasvApoWtEos3N(#486)
Plasmid#184107Purposecyclofen-inducible apoptosis activation and imaging (tEosFP) in zebrafish permanent transgenicDepositorInsertmyr-DIAP1-2nls-tEosFP-nls'-P2A-Casp9-ERT2
UseZebrafish transgenesis (blue eyes)MutationDIAP1: deleted 1-2, N19G, N20V, deleted 146-438; …Promoter4xUASAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only