We narrowed to 11,014 results for: phen
-
Plasmid#158345PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.V5_NGFR
Plasmid#158248PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.V5MutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.FLAG.HA_NGFR
Plasmid#158294PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.FLAG.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.FLAG_NGFR
Plasmid#158249PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-C4
Plasmid#73427PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-ZIP(FF)
Plasmid#27135DepositorUseLentiviralTagseGFP and mCherryExpressionMammalianMutationTyrosines in ITAMS 1-3 mutated to phenylalanines …Available SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
shCCL20
Plasmid#65096Purposeretroviral expression of CCL20 shRNADepositorAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.C.V5_NGFR
Plasmid#158331PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.C.V5MutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.FLAG_NGFR
Plasmid#158270PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.Ollas.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.VSVg_NGFR
Plasmid#158315PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Tag.C.S.Ollas_NGFR
Plasmid#158303PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsTag.C.S.OllasMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.C_NGFR
Plasmid#158268PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.Ollas.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.V5_NGFR
Plasmid#158310PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.V5MutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.FLAG_NGFR
Plasmid#158311PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.NWS_NGFR
Plasmid#158312PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.NWSMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.HA_NGFR
Plasmid#158313PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.VSVg.C_NGFR
Plasmid#158263PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.VSVg.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FLAG.VSVg.C_NGFR
Plasmid#158260PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsFLAG.VSVg.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*leu*
Plasmid#21173DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…Available SinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y357F-PolyA
Plasmid#112287PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y357F mutant _ corresponding to tyrosine 407 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationTyrosine 357 to Phenyalanine corresponding to tyr…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-TACC3KDP∆682-688-shTACC3
Plasmid#69116PurposeDual-promoter plasmid to express knockdown-proof human TACC3 (682-688aa ch-TOG binding site deleted) tagged with EGFP along with shRNA to knock down endogenous TACC3 in mammalian cells.DepositorInsertsUseRNAiTagsEGFPExpressionMammalianMutationDeletion of amino acids 682-688 (region containin…PromoterCMVAvailable SinceOct. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOPTH OROV N
Plasmid#229663PurposeExpress Oropouche virus BeAn 19991 nucleoprotein with N-terminal His6 tagDepositorInsertNucleoprotein
Tags6xHisExpressionBacterialPromoterT7Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_L436P
Plasmid#234559PurposeCTNNA1 eye phenotype via forward genetic screenDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-F97W
Plasmid#203572PurposeExpresses V5-tagged BCL-XL with partial drug resistance to A-1331852 in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationChanged Phenylalanine 97 to Tryptophan for partia…PromoterCMVAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pXYL-crtI-tNOS-pGPD-crtYB-tNOS+ku70 insD (SBE146)
Plasmid#195048Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pGPD-crtI-tNOS-pXYL-crtYB-tNOS+ku70 insD (SBE145)
Plasmid#195047Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pXYL-crtE-tNOS-pGPD-crtI-tNOS-pADH2-crtYB-tNOS+ku70 insD (SBE144)
Plasmid#195046Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only