12,913 results
-
Plasmid#173582PurposeExpresses a Bap1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Bap1 (Bap1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgDnmt3a#2/Cre
Plasmid#173588PurposeExpresses a Dnmt3a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Dnmt3a (Dnmt3a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRnf43#2/Cre
Plasmid#173614PurposeExpresses a Rnf43-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rnf43 (Rnf43 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtrx#2/Cre
Plasmid#173616PurposeExpresses a Atrx-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Atrx (Atrx Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgUbr5#2/Cre
Plasmid#173624PurposeExpresses a Ubr5-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ubr5 (Ubr5 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgWrn#1/Cre
Plasmid#173625PurposeExpresses a Wrn-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Wrn (Wrn Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLrp1b#2/Cre
Plasmid#173642PurposeExpresses a Lrp1b-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Lrp1b (Lrp1b Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKmt2c#2/Cre
Plasmid#173654PurposeExpresses a Kmt2c-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kmt2c (Kmt2c Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtm#1/Cre
Plasmid#173579PurposeExpresses a Atm-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Atm (Atm Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCic#1/Cre
Plasmid#173585PurposeExpresses a Cic-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Cic (Cic Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgGata3#2/Cre
Plasmid#173596PurposeExpresses a Gata3-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Gata3 (Gata3 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCmtr2#1/Cre
Plasmid#173631PurposeExpresses a Cmtr2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Cmtr2 (Ftsjd1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLats1#2/Cre
Plasmid#173600PurposeExpresses a Lats1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Lats1 (Lats1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSetd2#2/Cre
Plasmid#173615PurposeExpresses a Setd2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Setd2 (Setd2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgUbr5#1/Cre
Plasmid#173623PurposeExpresses a Ubr5-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ubr5 (Ubr5 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-mAK1-shRNA-1
Plasmid#185364PurposeFor mammalian expression of shRNA: ATCTTGACTCCCTGAAGTAAC that targets mouse AK1 (adenylate kinase)DepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRnf43#1/Cre
Plasmid#173613PurposeExpresses a Rnf43-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rnf43 (Rnf43 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSmad4#2/Cre
Plasmid#173618PurposeExpresses a Smad4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Smad4 (Smad4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLats1#1/Cre
Plasmid#173599PurposeExpresses a Lats1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Lats1 (Lats1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLrp1b#1/Cre
Plasmid#173641PurposeExpresses a Lrp1b-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Lrp1b (Lrp1b Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf1#2/Cre
Plasmid#173608PurposeExpresses a Nf1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf1 (Nf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#2/Cre
Plasmid#173610PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNcor1#1/Cre
Plasmid#173605PurposeExpresses a Ncor1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ncor1 (Ncor1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtrx#1/Cre
Plasmid#173612PurposeExpresses a Atrx-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Atrx (Atrx Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgDot1l#1/Cre
Plasmid#173589PurposeExpresses a Dot1l-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Dot1l (Dot1l Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgGata3#1/Cre
Plasmid#173595PurposeExpresses a Gata3-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Gata3 (Gata3 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgErcc4#1/Cre
Plasmid#173593PurposeExpresses a Ercc4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ercc4 (Ercc4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgWrn#2/Cre
Plasmid#173626PurposeExpresses a Wrn-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Wrn (Wrn Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-V5-Nxph1
Plasmid#184336PurposeExpression of V5-tagged mouse neurexophilin-1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-LRRK2/Dardarin, N-terminus [N138/6R]
Plasmid#182104PurposeMammalian Expression Plasmid of anti-LRRK2/Dardarin, N-terminus (Human). Derived from hybridoma N138/6.DepositorInsertanti-LRRK2/Dardarin, N-terminus (Homo sapiens) recombinant mouse monoclonal antibody (LRRK2 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only