We narrowed to 11,495 results for: ANG
-
Plasmid#248884PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with M336A.DepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only
-
TDP-43_CTD_S333A
Plasmid#248882PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with S333A.DepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_W334A
Plasmid#248883PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with W334A.DepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSS22-IRES-NLS-eGFP
Plasmid#241837PurposePart I of the Donor construct for UBE3A reporterDepositorInserteGFP
UseDonor plasmidAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDS48
Plasmid#241839PurposeCas9-gRNA construct targeting the UBE3A locusDepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pαH-NiV-F-WT-Foldon
Plasmid#200391PurposeMammalian cell expression of Nipah virus fusion proteinDepositorInsertNiV-F Ectodomain
TagsFoldon, HRV3C cleavage site, 8X His tag, 2X Strep…ExpressionMammalianAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEP17
Plasmid#229234PurposePutP (Sodium/proline symporter) under tet operator, TetRDepositorAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pS5
Plasmid#231614PurposeL-arabinose (Ara)- and anhydrotetracycline (aTc)-inducible inverter circuit reported by mKate and/or sfGFP fluorescence signalsDepositorInsertPbad-TetR-sfGFP-Ptet-AraC-mKate2
UseSynthetic BiologyExpressionBacterialPromoterPbad/PtetAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACB109
Plasmid#222208PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the K10N mutation and a C-terminal His tagDepositorInsertfghA (K10N)
Tags6x HisExpressionBacterialMutationChanged Lys10 to AsnPromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB110
Plasmid#222209PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the G258D mutation and a C-terminal His tagDepositorInsertfghA (G258D)
Tags6x HisExpressionBacterialMutationChanged Gly258 to AspartatePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB111
Plasmid#222210PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the G76V mutation and a C-terminal His tagDepositorInsertfghA(G76V)
Tags6x HisExpressionBacterialMutationChanged glycine 76 to valinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB112
Plasmid#222211PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the S11R mutation and a C-terminal His tagDepositorInsertfghA(S11R)
Tags6x HisExpressionBacterialMutationChanged Serine 11 to ArgininePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB113
Plasmid#222212PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the W15C mutation and a C-terminal His tagDepositorInsertfghA(W15C)
Tags6x HisExpressionBacterialMutationChanged Tryptophan 15 to CysteinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNMSB109
Plasmid#199322PurposeCombine with Gal4 to direct CaMBI 300 expressionDepositorInsert15xUAS::delta pes-10::::CaMBI::let-858 3'UTR
ExpressionWormMutationOrange CaMBI with 300 nM KD for calciumPromoter15xUAS:::delta pes-10Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+) ChemoB-CaM
Plasmid#193812PurposeProtein production of ChemoB-CaM in bacteriaDepositorInsertChemoB-CaM
Tags10xHisExpressionBacterialMutationEBFP2: N39Y, V206KPromoterT7Available SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS1
Plasmid#174301PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #1 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS2
Plasmid#174302PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #2 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only