We narrowed to 8,728 results for: lic
-
-
pSmart-EF1alpha-NlaCas7-p65
Plasmid#207394PurposeExpresses NlaCas7-p65 activator fusion in mammalian cellsDepositorInsertEF1a-NlaCas7-p65-bGH polyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCX:Ī³B2ĪICD-EC1-G4S-mTQ2ĪC6
Plasmid#209089PurposemTurquoise2-inserted PcdhgB2 lacking an intracellular domain (ICD)DepositorAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCX:Ī³B2-EC1-G4S-mTQ2ĪC6
Plasmid#209091PurposemTurquoise2-inserted PcdhgB2DepositorAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRMTK-clo5
Plasmid#203956PurposeCloning plasmid containing the chloramphenicol resistance gene insertDepositorInsertChloramphenicol Resistance Gene
ExpressionPlantPromoterCAT promoterAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRMTK-clo9
Plasmid#203960PurposeCloning plasmid containing the tetracycline resistance gene insertDepositorInsertTetracycline Resistance Gene
ExpressionPlantPromoterCAT promoterAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRMTK-clo12
Plasmid#203982PurposeCloning plasmid containing the rrnB T1 terminator insert with a chloramphenicol resistance markerDepositorInsertrrnB T1 Terminator
ExpressionPlantPromoterN/AAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Bn CAAX pcDNA3
Plasmid#206088PurposeCav2.2 N-terminus (amino acids 1-95) with a C-terminal tag of the final 10 aa of H.Ras containing CAAX motifDepositorAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Shim_ProRS_TP_GFP_pK7FWG2
Plasmid#202651PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic ProRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_ThrRS_TP_GFP_pK7FWG2
Plasmid#202652PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic ThrRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_TrpRS_TP_GFP_pK7FWG2
Plasmid#202653PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic TrpRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_MetRS_TP_GFP_pK7FWG2
Plasmid#202650PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic MetRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_AspRS_TP_GFP_pK7FWG2
Plasmid#202647PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic AspRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_GlyRS_TP_GFP_pK7FWG2
Plasmid#202648PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic GlyRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_AsnRS_TP_GFP_pK7FWG2
Plasmid#202649PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic AsnRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTC3cIfm
Plasmid#193778PurposeExpresses frame-shifted cI under the control of PLTetO-1 promoter, p15A origin of replication, Chloramphenicol selectionDepositorInsertFrame-shifted CI
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
GLRX-roGFP2 in pT3TS-Dest
Plasmid#194297PurposeIn vitro transcription of the redox sensor GLRX-roGFP2 from the T3 promoter. Parton lab clone KRKDepositorInsertGLRX-roGFP2
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3E-DrCavin1a
Plasmid#194291PurposeMultisite gateway entry clone for expression of codon optimised zebrafish cavin1a with fusion tag at the N-terminus. Parton lab clone KXMDepositorInsertcavin1a (cavin1a Zebrafish)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
RP51A-NoBS-NoPseudoBS
Plasmid#100986PurposeRP51A w/ T7 promoter in HindIII/EcoRI sites of pUC18. Has WT 5'ss but mutant BS and no pseudo BSDepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutationBS mutated to GTTAGTG, pseudo BS mutated to GTTTGā¦Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only
