We narrowed to 9,972 results for: crispr plasmids
-
Plasmid#235047PurposeLentiviral sgRNA expression with optimized sgRNA scaffold vector with hygromycin and superfolder GFP. Also contains ccdB cassette for library cloning.DepositorArticleTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pBC-Msk1
Plasmid#251970PurposeProduction of MSK1 protein. This plasmid is also called Msk1 in the paper.DepositorInsertMsk1
TagsV5-6xHisExpressionBacterialPromoterT7, lacOAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBC-tMsk1
Plasmid#251971PurposeProduction of truncated MSK1 protein. This plasmid is also called tMsk1 in the paper.DepositorInserttMsk1
TagsV5-6xHisExpressionBacterialMutationdeleted aa 1-26PromoterT7, lacOAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-GCaMP6f
Plasmid#209931PurposeCre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter. Based on construct from Pouchelon et al Cell Rep Methods. 2022.DepositorInsertGCaMP6f
UseAAV, CRISPR, and Cre/LoxExpressionMammalianPromoterhSynAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-Chrimson-mRuby
Plasmid#209930PurposeCre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of mRuby-tagged Chrimson in neurons under the control of the hSyn1 promoter.DepositorInsertChrimson-mRuby
UseAAV, CRISPR, and Cre/LoxExpressionMammalianPromoterhSynAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-TLCV2
Plasmid#196331Purposethe TLCV2 plasmid with Tol2 recombination sites for integrationDepositorInsertCas9-2A-eGFP
UseCRISPR; Fish expressionExpressionBacterial, Mammalian, and Y…PromoterTight TRE promoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgCTG-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222857PurposeThis plasmid codes for the Slug-KH nickase with a sg(CTG)6DepositorInsertSlug-KHD10A+sgCTG
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgAGC-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222859PurposeThis plasmid codes for the Slug-KH nickase with a sg(AGC)6DepositorInsertSlug-KHD10A+sgAGC
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgCAG-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222858PurposeThis plasmid codes for the Slug-KH nickase with a sg(CAG)6DepositorInsertSlug-KHD10A+sgCAG
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgGCA-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222860PurposeThis plasmid codes for the Slug-KH nickase with a sg(GCA)6DepositorInsertSlug-KHD10A+sgGCA
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-GeneTRAP
Plasmid#218187PurposeTo KO and genetrap mouse Vamp2 simultaneouslyDepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEARBOCS-v0- Gfap-TagIN-mCherry
Plasmid#196490PurposeTo tag endogenous mouse GFAP with mCherryDepositorInsertsmCherry
gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEARBOCS-v0-Vamp2-TagIN-HA
Plasmid#196494PurposeTo tag endogenous mouse VAMP2 with HADepositorInsertsHA
gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-ODN-hsRPL3-CterTwStrep
Plasmid#208644Purposefor long single strand DNA donnor preparation for Twin Strep tag knock-in at C ter of human RPL3. Digest with nt.BspQI and nb.BsrDI to get ssDNA. This plasmid will cause re-edit and fail knock-in.DepositorInsertTwin Strep tag with RPL3 genome HomoArm (RPL3 Synthetic, Human)
UseCRISPR; Ssdna donnor preparationTagsTwin StrepAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHACK-QF2-AgU6-mCherry
Plasmid#184530PurposeHACK-compatible plasmid for generating T2A-QF2 knockins in Anopheles mosquitoes with a mCherry selectable marker.DepositorInsertQF2
UseCRISPRPromoterAnopheles U6 promoterAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBM10a
Plasmid#179688PurposeTarget plasmid for context profilingDepositorInsertACA target
ExpressionBacterialAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-CAAAG
Plasmid#170096PurposedeGFP reporter plasmid with CAAAG PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-CAATG
Plasmid#170097PurposedeGFP reporter plasmid with CAATG PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-GTAAT
Plasmid#170098PurposedeGFP reporter plasmid with GTAAT PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only