We narrowed to 24,876 results for: promoter
-
Plasmid#247860PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged SLX4 D556-637DepositorInsertSLX4 (SLX4 Human)
TagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianMutationdeletion of amino acid 556-637Available SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiX_(loxPconDIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG3906
Plasmid#246345PurposeloxPcon DIAL Reporter Lentivirus expressing mCherry-HRasG12V in the presence of ZFaDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-DIAL-YB_TATA)-Halo-p53-BGH_pKG2745
Plasmid#246339Purpose203-bp DIAL Reporter Plasmid with YB_TATA expressing Halo-p53 in the presence of ZFa and editable by Cre recombinaseDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP965
Plasmid#239887PurposeWild type CaMV 35S promoter engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2CR-QUAS:mNeonGreen-NES-P2A-mKate2-NLS
Plasmid#241912PurposeZebrafish transgenesis plasmid encoding cytoplasmic mNeonGreen-NES and mKate2-NLS separated by the P2A peptide, driven by the QUAS enhancer, and including a cmlc2:mKate2 cardiac transgenesis markerDepositorInsertQUAS enhancer driving mNeonGreen-NES and mKate2-NLS
UseZebrafish tol2 transgenesisPromoterQUASAvailable SinceOct. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2CG2-QUAS:cPla2-mKate2
Plasmid#241913PurposeZebrafish transgenesis plasmid encoding D. rerio cPla2-mKate2, driven by the QUAS enhancer, and including a cmlc2:EGFP cardiac transgenesis markerDepositorInsertQUAS enhancer driving cPla2-mKate2
UseZebrafish tol2 transgenesisTagscPla2 fused to mKate2PromoterQUASAvailable SinceOct. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2CR-QUASM1:GCaMP7s-NLS-P2A-mKate2-NLS
Plasmid#241915PurposeZebrafish transgenesis plasmid encoding GCaMP7s-NLS and mKate2-NES separated by the P2A peptide, driven by the QUASM1 enhancer, and including a cmlc2:mKate2 cardiac transgenesis markerDepositorInsertQUASM1 enhancer driving GCaMP7s-NLS and mKate2-NLS
UseZebrafish tol2 transgenesisPromoterQUASM1Available SinceOct. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-mCherry-Eea1[36-126]-mCherry
Plasmid#246260PurposeRab5 sensor acceptorDepositorAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-mCherry-FYCO1[963-1206]-mCherry
Plasmid#246264PurposeRab7 sensor acceptorDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ARHGEF7/B-Pix
Plasmid#241368PurposeMammalian expression of SpCas9 and gRNA targeting ARHGEF7 (β-Pix)DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-IRES-NEO-NF2(1-27)-SNAP-tag
Plasmid#241401PurposeLentiviral expression of SNAP-tagged NF2 fragment (aa 1-27)DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
XLone-UCE intron (DF3-2)
Plasmid#242186PurposeExpress doxycycline inducible CRNDE UCE intron with deletion of the eIF6 binding site F3-2 in mammalian cellsDepositorInsertCRNDE UCE intron (DF3-2) (CRNDE Human)
ExpressionMammalianMutationF3-2 site deleted (70 bp)PromoterTRE3GSAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CHGA-eGFP
Plasmid#228569PurposeExpresses GFP-tagged human Chromogranin A in mammalian cellsDepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPc1 PTEN C124S
Plasmid#237340Purposetransient overexpression in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
SB-CAG-mKate2-P2A-NANOG-IP
Plasmid#236768PurposeA sleeping beauty-based vector containing CAG promoter-driven mKate2-P2A-NANOG-IRES-Pac.DepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
SB-CAG-mCherry-P2A-EIF3D-IP
Plasmid#236769PurposeA sleeping beauty-based vector containing CAG promoter-driven mCherry-P2A-EIF3D-IRES-Pac.DepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only