We narrowed to 26,123 results for: expression vector
-
-
pSBbi-pur H-2Kb
Plasmid#111623PurposeSleeping Beauty transposon vector encoding H-2Kb mouse MHC Class I alleleDepositorInsertH2Kb
ExpressionMammalianPromoterEF1alphaAvailable SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGW_RUBY_EggCas9
Plasmid#225990PurposeTo clone entry vector with CRISPR guide RNA via Gateway cloning; it has an Egg cell-specific expression of Cas9 and the plant is selected by the red color due to constitutive expression of RUBYDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-ymScarletI-SpHis5
Plasmid#219844Purposetagging vector to tag genes with ymScarletI and a HIS5 geneDepositorInsertymScarletI-SpHis5
TagsymScarletIExpressionYeastAvailable SinceAug. 27, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAC155-pCR8-sgExpression
Plasmid#49045PurposeU6-driven sgRNA expressing cassette on a gateway donor vectorDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
rAAV2/MG1.2
Plasmid#184541PurposeAAV packaging plasmid, expressing Rep2 and AAV-MG1.2 capsidDepositorInsertAAV-MG1.2 capsid
UseAAV; Helper vector for packagingMutationchanges on AAV9 capsid: K449R, Q588T; insertion o…Available SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
rAAV2/MG1.1
Plasmid#184540PurposeAAV packaging plasmid, expressing Rep2 and AAV-MG1.1 capsidDepositorInsertAAV-MG1.1 capsid
UseAAV; Helper vector for packagingMutationchanges on AAV9 capsid: K449R, A587L, Q588M; inse…Available SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
rAAV2/cMG
Plasmid#184539PurposeAAV packaging plasmid, expressing Rep2 and AAV-cMG capsidDepositorInsertAAV-cMG capsid
UseAAV; Helper vector for packagingMutationchanges on AAV9 capsid: K449R, A589D; insertion o…Available SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-HA-mCherry-pA
Plasmid#233029PurposeTo Express HA Tagged hfCas13d-mCherry fusion protein from the mammalian EFS promoterDepositorInserthfCas13d-mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSP6-RNAP
Plasmid#48143PurposeShuttle vector E. coli/B.meg.; encoding the RNA polymerase of the phage SP6 under control of the xylose inducible promoter PxylADepositorInsertrna polymerase SP6
UseSynthetic BiologyExpressionBacterialMutationV314A (numbering based on NCBI Sequence ID: NP_85…Available SinceOct. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pK168.AAV-EF1α-DIO-tTA-P2A-RFP-WPRE (Supernova)
Plasmid#85039PurposeFor AAV-TRE-Cre based Supernova-RFP, pK168 should be used with pK170.DepositorInsertRFP-P2A-tTA
UseAAVExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’-LMNA-eGFP-KI
Plasmid#170545PurposeExpresses a sgRNA for 5' tagging to LMNA and contains a cassette with eGFP flanked by homology arms for LMNADepositorInsertsLeft Homology arm for LMNA knockin
Right Homology arm for VIM knockin
UseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
p20StAD
Plasmid#190268PurposeConstitutively expresses a protein of interest fused to a GAL4 transcription activating domain. Targeted integration to genomic locus YPRC-delta15, Chromosome XVI.DepositorTypeEmpty backboneUseSynthetic Biology; Yeast genome-integrating vectorTagsGAL4-ADPromoterTDH3Available SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
rAAV2/cMG.WPP
Plasmid#184542PurposeAAV packaging plasmid, expressing Rep2 and AAV-cMG.WPP capsidDepositorInsertAAV-cMG.WPP capsid
UseAAV; Helper vector for packagingMutationchanges on AAV9 capsid: K449R; insertion of WPPKT…Available SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
rAAV2/cMG.QRP
Plasmid#184543PurposeAAV packaging plasmid, expressing Rep2 and AAV-cMG.QRP capsidDepositorInsertAAV-cMG.QRP capsid
UseAAV; Helper vector for packagingMutationchanges on AAV9 capsid: K449R; insertion of QRPPR…Available SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-EFS-CasRx-pA
Plasmid#192488PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterEFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFX-Pickles 2.34NES
Plasmid#100028PurposeImproved FRET biosensor for the measurement of BCR-ABL activity.DepositorInsertPickles-2.34NES
UsePfx vector is derived from pcmv vector.ExpressionMammalianPromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG ID2
Plasmid#98390PurposeGateway entry vector for inducible expression of human ID2 with N-terminal 3xFLAG tagDepositorAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only
