We narrowed to 2,901 results for: aen
-
Plasmid#229867PurposeEntry vector with cGAL[cGAL(DBD)-linker-QFAD]-tbb-3'UTR in slot 5 (for SapTrap assembly)DepositorInsertcGAL[cGAL(DBD)-linker-QFAD]-tbb-3'UTR
ExpressionWormAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::lite-1G::SL2::his-24::tagBFP
Plasmid#232610PurposePan-neuronal expression of 'LITE-1' using a genomic fragment and fluorophore 'tagBFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::gur-3G::SL2::his-24::tagBFP
Plasmid#232608PurposePan-neuronal expression of 'GUR-3' using a genomic fragment and fluorophore 'tagBFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::prdx-2G::SL2::his-24::tagRFP
Plasmid#232609PurposePan-neuronal expression of 'PRDX-2' using a genomic fragment and fluorophore 'tagRFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1221
Plasmid#229873Purposegene trap RMCE plasmid with QF-act-4 3' UTR::SEC for RMCE cloned in the destination vector pHW1133 to swap driver via RMCEDepositorInsertQF-act-4 3' UTR::SEC
ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1143
Plasmid#229866PurposeEntry vector with FRT-SA-ArtificialExon-3xStopCodons-SL2-AAAA in slot 4 (for SapTrap assembly)DepositorInsertFRT-SA-ArtificialExon-3xStopCodons-SL2-AAAA
ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-CeAIN2-W390A_P
Plasmid#147236PurposeInsect Expression of CeAIN2-W390ADepositorInsertCeAIN2-W390A
ExpressionInsectMutationDeletion of two AA SD 378-379 compared to the seq…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only