We narrowed to 811 results for: mRuby
-
Plasmid#129006PurposeIntegration vector for optogenetic machinery (pMEDIUM-VP16-CIB1/pMEDIUM-ZCRY2PHR) and pZF-mRUBY2DepositorInsert5' URA3-pRPL18B-SV40NLS-VP16-CIB1-tENO1-pRPL18B-SV40NLS-ZiF268DBD-CRY2PHR-tSSA1-pZF(BS)-mRUBY2-tADH1-URA3 URA3 3'-KanR-ColE1
ExpressionYeastAvailable SinceOct. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB365
Plasmid#124048PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to mRuby2 P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::mRuby2-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM2_4
Plasmid#183057PurposeHAA1-mTurquoise2 under HAA1p and mRuby2 under YGP1p with flanks for genome integration into HO locusDepositorInsertsmRuby2
HAA1-mTurquoise2
UseSynthetic BiologyTagsmRuby2 and mTurquoise2ExpressionYeastPromoterHAA1 and YGP1Available SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-EKAR
Plasmid#181858PurposeGenetically encoded FRET-based sensor for monitoring ERK activity near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-EKAR
TagsmRuby2 and sfGFP(1-10)ExpressionMammalianPromoterCMVAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-H2BC11-mR2
Plasmid#183866PurposeRepair template for the C-terminal tagging of H2B histones with mRuby2 in human cells using CRISPR/Cas9.DepositorInsertH2BC11 homology arms with linker-mRuby2 (H2BC11 Human)
UseCRISPR; Donor templateTagslinker-mRuby2ExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mR2-MYH10
Plasmid#183869PurposeRepair template for the N-terminal tagging of myosin heavy chain 10 with mRuby2 in human cells using CRISPR/Cas9.DepositorInsertMYH10 homology arms with mRuby2-linker (MYH10 Human)
UseCRISPR; Donor templateTagsmRuby2-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGD431
Plasmid#132382Purposecontains the sequence of mRuby3for C-term fusions in the pGGD000 backbone (GreenGate)DepositorInsertmRuby3
UseGreengate entry plasmidAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYSD153
Plasmid#212929PurposeEncodes the mRuby2 fluorescent protein (Part3b') with the 111AA SCW4 TFP (Part3a') assembled with S. cerevisiae pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertmRuby2
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD141
Plasmid#212928PurposeEncodes the mRuby2 fluorescent protein (Part3b') with the Aga2 signal peptide (Part3a') assembled with S. cerevisiae pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertmRuby2
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMM0638
Plasmid#129005PurposeIntegration vector for optogenetic machinery (pSTRONG-VP16-CIB1/pMEDIUM-ZCRY2PHR) and pZF-mRUBY2DepositorInsert5' URA3 -pTEF1-SV40NLS-VP16-CIB1-tENO1-pRPL18B-SV40NLS-ZiF268DBD-CRY2PHR-tSSA1-pZF(BS)-mRUBY2-tADH1-URA3 URA3 3'- KanR-ColE1
ExpressionYeastAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJB1338
Plasmid#218592PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22DepositorInsertPex22
ExpressionYeastMutationPex22(1-36)Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1340
Plasmid#218593PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22. Also overexpresses Pex11DepositorInsertPex22
ExpressionYeastMutationPex22(1-36)Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTS2339_Tier3(SB)-Ruby_Puro
Plasmid#169637PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a mRuby2 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mRuby2-p2A-PuroR-pA-3'ITR)DepositorInsertPRPBSA-driven mRuby2 and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2354_Tier3(PB)-Ruby_PuroR
Plasmid#169653PurposeTier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a mRuby2 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mRuby2-p2A-PuroR-pA-3'ITR)DepositorInsertPRPBSA-driven mRuby2 and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSWD95D293A
Plasmid#159099PurposeCckA FRET Sensor with DITE motif mutantDepositorInsertCckA 1-182, Linker SNVTRHRSATE, mClover3, CckA 183-691 (D293A), Linker SNVTRHRSAT, mRuby3
ExpressionBacterialMutationCckA D293 mutated to A293 and V199I on mRuby3 (P…PromoterXyloseAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSJD001
Plasmid#158589PurposePex22(1-36)-mRuby2 peroxisome markerDepositorInsertPex22(1-36)-mRuby2
ExpressionYeastAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGD253
Plasmid#132374Purposecontains the sequence of mRuby2 for C-term fusions in the pGGD000 backbone (GreenGate)DepositorInsertmRuby2
UseGreengate entry plasmidAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYTK046
Plasmid#65153PurposeEncodes mRuby2 as a Type 3b part to be used in the Dueber YTK systemDepositorInsertmRuby2
ExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-R/G-ICUE
Plasmid#181849PurposeICUE cAMP sensor using sfGFP and mRuby2 as the FRET donor and acceptor.DepositorInsertR/G-ICUE (RAPGEF3 Human)
TagsmRuby2 and sfGFPExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only