We narrowed to 24,482 results for: c-myc
-
Plasmid#121475PurposeCEN TRP1 CNA1ΔAIDDepositorInsertCNA1deltaAID
UseYeast cen vectorMutationTruncated after amino acid 508PromoterEndogenous genomic promoter regionAvailable SinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTJK519
Plasmid#121476PurposeCEN TRP1 CNA1ΔCBDDepositorInsertCNA1deltaCBD
UseYeast cen vectorMutationTruncated after amino acid 453PromoterEndogenous genomic promoter regionAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pLenti-TK-Firefly-Control
Plasmid#122277PurposeLentiviral vector for stable expression of Firefly luciferase.DepositorInsertFirefly luciferase
UseLentiviral and LuciferaseExpressionBacterialPromoterThymidine kinaseAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-G-Flamp2
Plasmid#192782Purposegreen biosensor for cAMP in mammalian cellsDepositorInsertG-Flamp2
TagsHis tagExpressionMammalianPromoterCAGAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV-3xFLAG-gateway-EGFP
Plasmid#122845PurposeN-terminal 3xFLAG tag and C-terminal EGFP tag. Gateway destination vector for mammalian expression.DepositorTypeEmpty backboneUseGateway CloningTags3xFLAG and EGFPExpressionMammalianPromoterCMVAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-Z3EV
Plasmid#157659PurposeGFP gene and gRNA under Z3EV expression control (estradiol sensor), with Z3EV transcription factor to insert in the genome.DepositorInsertGFP-gRNA NatMX Z3EV
UseInsert storage (replicative in e. coli)Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-LEU2
Plasmid#157656PurposeGFP and gRNA tag for protein and mRNA quantification, to attache to the 3' end of the gene coding sequenceDepositorInsertGFP-gRNA
UseInsert storage (replicative in e. coli)TagsGFP-gRNAAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Plas-CRISPR_reporter
Plasmid#157658PurposeCRISPR reporter for mRNA quantification, integrative plasmid into NPR2 geneDepositorInsertdCAS9-VP64, mCherry, KanMX
UseInsert storage (replicative in e. coli)MutationN28D in mCherry- please see depositor comments be…Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHACK(Gal4)-DONR(T2A-Flp1)
Plasmid#194770PurposeTo insert T2A-Flp1 into Gal4 coding sequence in Drosophila, converting Gal4 into a T2A-Flp1 transgene.DepositorInsertT2A-Flp1
UseCRISPRExpressionInsectAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hMed25
Plasmid#206958PurposeThe ORF of human Med25 cDNA amplified from the RT human liver RNA was cloned into pGEMTE vector and then subclone at XhoI/XbaI sites of the pcDNA3.2(+), the mammalian expression vector.DepositorInsertHomo sapiens mediator complex subunit 25 (MED25), transcript variant 1, mRNA (MED25 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJP118
Plasmid#176494PurposeExpresses Lifeact-mScarlet under control of the Capsaspora EF1 promoter and HygR under control of the Capsaspora actin promoterDepositorInsertLifeact peptide
UseCapsaspora owczarzaki expressionAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-) Full length Her2(ERBB2)-Fc
Plasmid#194330PurposeMammalian expression of full length Human epidermal growth factor (Her)-2-Fc fusion proteinDepositorAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOn-puro-ICP4-∆CTA
Plasmid#250613PurposeMammalian lentiviral vector for the inducible (TetOn) expression of codon-optimized HSV-1 ICP4 lacking the entire C-terminus (from HSV-1 n208 virus)DepositorInsertICP4-n208
UseLentiviralExpressionMammalianMutationCodon-optimized ICP4 is truncated after first 774…PromoterTRE3GS promoterAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only