We narrowed to 24,516 results for: crispr
-
Plasmid#106159PurposeEasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6682 into Yarrowia lipolytica chromosomal location IntC_2, amp resistanceDepositorInsertunknown
ExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU1/Sm/3' Box_(GLuc)_INT
Plasmid#68438PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U1Pro/SmBox/3' Box expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U1Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmaxRH
Plasmid#206884PurposeExpresses FLAG-tagged PEmax (lacking the RNAseH domain) fused to Gag through a linker sequenceDepositorInsertPEMax Delta RNAseH
TagsFLAGPromoterCMVAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(CTRL)-CMV-eGFP
Plasmid#194017PurposeExpresses a gRNA that targets the LacZ gene (serves as control) and eGFPDepositorInsertssgRNA(CTRL)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAT105
Plasmid#180510PurposePlasmid expressing mammalian codon optimized engineered DpbCasX-R3, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
DpbCasX with R3 loop
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP308-pAAV-EFS-dSaCas9-VP64-Dio-pA
Plasmid#113685PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription activator VP64. dSaCas9-VP64 is floxed to render the system cre-dependent.DepositorInsertinverted de-catalyzed SaCas9
UseAAV, CRISPR, Cre/Lox, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 Tnos:nptII:Pnos - SF - P35S:hCas9:Tnos (GB1656)
Plasmid#160618PurposeModule for the expression of the human codon optimized Cas9 and kanamycin resistance (NptII).DepositorInsertTnos:NptII:Pnos-SF-P35s:hCas9:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-MYC-Guide-hSpCas9
Plasmid#228574PurposeExpression of human MYC gRNA; CRISPR mediated gene insertionDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-D156R (ttLbCas12a)
Plasmid#195366PurposeA temperature-tolerant LbCas12a mutant (D156R), also known as ttLbCas12aDepositorInsertLbCas12a-D156R (ttLbCas12a)
UseCRISPR; Gateway compatible lbcas12a-d156r (ttlbca…ExpressionPlantPromoterZmUBI1Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBRC1
Plasmid#183064PurposeBase editing plasmid for Pseudomonas chlororaphisDepositorInserteSpCas9ppD10A
UseCRISPR and Synthetic BiologyAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDF0114 pu6-eco31i-eco31i-dis7-11-mature-dr-guide-scaffold
Plasmid#186981Purposemammalian expression of Cas7-11 crRNA guideDepositorInsertmature DR guide
ExpressionMammalianAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMTP140 (pBAD322G_TniQ-Cascade(Tn6900))
Plasmid#164262PurposeVector expressing the TniQ, Cas8/5, Cas7, and Cas6 proteins from the Tn6900 element with an arabinose promoter.DepositorInsertCodon-optimized tniQ-cas8/5-cas7-cas6 operon from Tn6900 from A. salmonicida S44 pS44-1
ExpressionBacterialAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRI006-pYFAC-riboB-PgpdA-dSpCas9-VPR-TtrpC
Plasmid#140199PurposeEpisomal expression of dSpCas9-VPR. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdSpCas9-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSPromoterPgpdAAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
library backbone 3'LTR gRNA and barcode
Plasmid#127397PurposeDigestion by BstXI and BamHI to release the backboneDepositorTypeEmpty backboneUseLentiviralTagsPuro-mCherryAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria3
Plasmid#124855PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a6
Plasmid#124860PurposeMutagenesis of Slc17a6DepositorInsertSlc17a6 (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a8
Plasmid#124861PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
SGL40C.EFS.E2Crimson
Plasmid#100894PurposeLentiviral gRNA deliveryDepositorInsertE2Crimson
Available SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only