We narrowed to 12,086 results for: HAL;
-
Plasmid#220296Purposemammalian expression of Bcl-2-F104C tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only
-
GFP-Bcl-2-ΔBH3
Plasmid#220299Purposemammalian expression of Bcl-2-ΔBH3 tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-ΔBH2
Plasmid#220298Purposemammalian expression of Bcl-2-ΔBH2 tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-T132L
Plasmid#220303Purposemammalian expression of Bcl-2-T132L tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-A131L
Plasmid#220302Purposemammalian expression of Bcl-2-A131L tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-G128L
Plasmid#220301Purposemammalian expression of Bcl-2-G128L tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKM 1996
Plasmid#217825PurposeExpresses putative photoreceptor SA-phr1 from S. alba. This gene shows high homology to the phr genes in prokaryotes.DepositorInsertSA-phr1
TagsMaltose-binding proteinExpressionBacterialAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGWB602-OEP7-mVenus
Plasmid#213864PurposeBinary vector for the expression of mVenus flanked with an N-terminal 50 amino acids of chloroplas outer envelope membrane transit peptide in plants.DepositorInsertchloroplast outer envelope membrane transit peptide fused mVenus (OEP7 Mustard Weed)
ExpressionBacterial and PlantAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtTAS1c-D2-NbSu-2-AtMIR173a
Plasmid#213401PurposePlant expression vector (2x35S) for expressing a syn-tasiRNA against Nicotiana benthamiana SULFUR gene from AtTAS1c precursorDepositorInsertArabidopsis TAS1c with a syn-tasiRNA sequence at D2 for silencing N. benthamiana SULFUR gene. MIR173 cassette.
ExpressionPlantPromoter2x35SAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLeo-A-a2-GEMS(PLCG)
Plasmid#209114PurposeTransient mammalian expression of the CC functionalized GEMS receptor A-a2-GEMS (PLCG)DepositorInsertA-a2-GEMS(PLCG)
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6 N352A HA
Plasmid#208365PurposeExtracellular HA-tagged Fzd6 N352A (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6 S354I HA
Plasmid#208364PurposeExtracellular HA-tagged Fzd6 S354I (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6HA
Plasmid#208363PurposeExtracellular HA-tagged Fzd6 (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-HD2C-ZF
Plasmid#200917PurposeExpress HD2C-ZF108 in Arabidopsis target FWA geneDepositorInsertHD2C (HD2C Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-CPL2-ZF
Plasmid#200918PurposeExpress CPL2-ZF108 in Arabidopsis target FWA geneDepositorInsertCPL2 (CPL2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-JMJ18-ZF
Plasmid#200919PurposeExpress JMJ18-ZF108 in Arabidopsis target FWA geneDepositorInsertJMJ18 (JMJ18 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-ELF7-ZF
Plasmid#200920PurposeExpress ELF7-ZF108 in Arabidopsis target FWA geneDepositorInsertELF7 (ELF7 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-DMS3-ZF
Plasmid#200921PurposeExpress DMS3-ZF108 in Arabidopsis target FWA geneDepositorInsertDMS3 (DMS3 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only